Formatting and quality control of eDNA metabarcoding data (intertidal dataset)

Author

Dina-Leigh Simons

Introduction

This pipeline aims to bridge outputs from the bioinformatics processing (in this case, DADA2) to ecological community analyses.

Load packages

list.of.packages <- c("dplyr", 
                      "tidyverse", 
                      "phyloseq", 
                      "seqinr", 
                      "dada2", 
                      "sjmisc", 
                      "worrms",
                      "taxize",
                      "tibble", 
                      "taxadb",
                      "reshape2",
                      "decontam",
                      "microViz",
                      "cowplot",
                      "devtools",
                      "qiime2R", 
                      "microbiome",
                      "vegan",
                      "ggforce",
                      "ANCOMBC")

new.packages <- list.of.packages[!(list.of.packages %in% installed.packages()[,"Package"])]
if(length(new.packages)) install.packages(new.packages)

invisible(lapply(list.of.packages, library, character.only = TRUE))

Importing data

We’ll first load all the required data, including outputs from the taxonomic assignment (.txt files), ASV data (.tsv and .fasta) and metadata (.csv).

Taxonomic assignments

We BLASTed ASVs against curated databases (MIDORI2 for CO1, Silva for 18S) separately for five regions: Scotland, North and South Wales, Northeast England, and Southwest England.

The BLAST results were then processed using MEtaGenome ANalyzer (MEGAN), which parses the alignments and assigns taxonomy using the Lowest Common Ancestor (LCA) algorithm. This approach ensures accurate taxonomic classification by considering multiple hits while conservatively resolving ambiguous assignments.

#Scotland----
SCH_18S_taxa<- read.table("Input_Data/MEGAN_data/SCH_18S_ASVs_blast_out_SILVA_98-ex.txt", header = F) #Scotland 18S
colnames(SCH_18S_taxa)<- c("ASV", "taxonomy")

SCH_CO1_taxa<- read.table("Input_Data/MEGAN_data/SCH_CO1_ASVs_blast_UNIQ_MIDORI_98-ex.txt", header = F) #Scotland CO1
colnames(SCH_CO1_taxa)<- c("ASV", "taxonomy")

#North wales----
NW_18S_taxa<- read.table("Input_Data/MEGAN_data/NW_18S_ASVs_blast_out_SILVA_98-ex.txt", header = F) #North Wales 18S
colnames(NW_18S_taxa)<- c("ASV", "taxonomy")

NW_CO1_taxa<- read.table("Input_Data/MEGAN_data/NW_CO1_ASVs_blast_UNIQ_MIDORI_98-ex_1per.txt", header = F) #North Wales CO1
colnames(NW_CO1_taxa)<- c("ASV", "taxonomy")

#South Wales----
SW_18S_taxa<- read.table("Input_Data/MEGAN_data/SW_18S_ASVs_blast_out_SILVA_98-ex.txt", header = F) #South Wales 18S
colnames(SW_18S_taxa)<- c("ASV", "taxonomy")

SW_CO1_taxa<- read.table("Input_Data/MEGAN_data/SW_CO1_ASVs_blast_UNIQ_MIDORI_98-ex.txt", header = F) #South Wales CO1
colnames(SW_CO1_taxa)<- c("ASV", "taxonomy")

#Northeast England----
NE_18S_taxa<- read.table("Input_Data/MEGAN_data/NE_18S_ASVs_blast_out_SILVA_98-ex.txt", header = F) #Northeast 18S
colnames(NE_18S_taxa)<- c("ASV", "taxonomy")

NE_CO1_taxa<- read.table("Input_Data/MEGAN_data/NE_CO1_ASVs_blast_UNIQ_MIDORI_98-ex.txt", header = F) #Northwast CO1
colnames(NE_CO1_taxa)<- c("ASV", "taxonomy")

#Southwest England (Cornwall)----
CN_18S_taxa<- read.table("Input_Data/MEGAN_data/CN_18S_ASVs_blast_out_SILVA-1per_98.txt", header = F) #Cornwall 18S
colnames(CN_18S_taxa)<- c("ASV", "taxonomy")

CN_CO1_taxa<- read.table("Input_Data/MEGAN_data/CN_CO1_ASVs_blast_UNIQ_MIDORI-1per_98.txt", header = F) #Cornwall CO1
colnames(CN_CO1_taxa)<- c("ASV", "taxonomy")

#Controls----
Controls_18S_taxa<- read.table("Input_Data/MEGAN_data/Controls_reps_18S_ASVs_blast_out_SILVA_98-ex.txt", header = F) #Controls 18S
colnames(Controls_18S_taxa)<- c("ASV", "taxonomy")

Controls_CO1_taxa<- read.table("Input_Data/MEGAN_data/Repeats_CO1_ASVs_blast_UNIQ_MIDORI_98-ex.txt", header = F) #Controls CO1
colnames(Controls_CO1_taxa)<- c("ASV", "taxonomy")

Let’s take a look at one of the MEGAN outputs. This file shows the ASVs detected in Scotland derived from the CO1 gene.

head(SCH_CO1_taxa)
        ASV                taxonomy
1   ASV_820 Paramoeba pemaquidensis
2 ASV_18576      Vexillifera kereti
3 ASV_22679      Vexillifera kereti
4   ASV_280       Parvamoeba rugata
5 ASV_10580       Parvamoeba rugata
6 ASV_20723       Parvamoeba rugata

ASV data

Now we import the ASV count and sequence information for each region, obtained using DADA2. We have to do a bit of wrangling to get the fasta file into the correct format.

#Scotland----
SCH_asv_count_18S <- read.table("Input_Data/HPC_processed_data/SCH_18S/06_ASV_counts_SCH_18S.tsv") #Scotland 18S counts
SCH_asv_fasta_18S <- read.fasta("Input_Data/HPC_processed_data/SCH_18S/06_ASV_seqs_SCH_18S.fasta")#Scotland 18S fasta
SCH_asv_fasta_18S_df <- data.frame(ASV=names(SCH_asv_fasta_18S), 
                                   Seqs=unlist(getSequence(SCH_asv_fasta_18S, as.string=T))) #turn into data frame
SCH_asv_fasta_18S_df$Seqs<- toupper(SCH_asv_fasta_18S_df$Seqs) #upper case Seqs

SCH_asv_count_CO1 <- read.table("Input_Data/HPC_processed_data/SCH_COI/06_ASV_counts_SCH_CO1_names.tsv") #Scotland CO1S counts
SCH_asv_fasta_CO1 <- read.fasta("Input_Data/HPC_processed_data/SCH_COI/06_ASV_seqs_SCH_CO1_names.fasta")#Scotland CO1 fasta
SCH_asv_fasta_CO1_df <- data.frame(ASV=names(SCH_asv_fasta_CO1), 
                                   Seqs=unlist(getSequence(SCH_asv_fasta_CO1, as.string=T))) #turn into data frame
SCH_asv_fasta_CO1_df$Seqs<- toupper(SCH_asv_fasta_CO1_df$Seqs) #upper case Seqs

#North Wales----
NW_asv_count_18S <- read.table("Input_Data/HPC_processed_data/NW_18S/06_ASV_counts.tsv") #North Wales 18S counts
NW_asv_fasta_18S <- read.fasta("Input_Data/HPC_processed_data/NW_18S/06_ASV_seqs.fasta")#North Wales 18S fasta
NW_asv_fasta_18S_df <- data.frame(ASV=names(NW_asv_fasta_18S), 
                                  Seqs=unlist(getSequence(NW_asv_fasta_18S, as.string=T))) #turn into data frame
NW_asv_fasta_18S_df$Seqs<- toupper(NW_asv_fasta_18S_df$Seqs) #upper case Seqs

NW_asv_count_CO1 <- read.table("Input_Data/HPC_processed_data/NW_CO1/06_ASV_counts.tsv") #North Wales CO1 counts
NW_asv_fasta_CO1 <- read.fasta("Input_Data/HPC_processed_data/NW_CO1/06_ASV_seqs.fasta")#North Wales CO1 fasta
NW_asv_fasta_CO1_df <- data.frame(ASV=names(NW_asv_fasta_CO1), 
                                  Seqs=unlist(getSequence(NW_asv_fasta_CO1, as.string=T))) #turn into data frame
NW_asv_fasta_CO1_df$Seqs<- toupper(NW_asv_fasta_CO1_df$Seqs) #upper case Seqs

#South Wales----
SW_asv_count_18S <- read.table("Input_Data/HPC_processed_data/SW_18S/06_ASV_counts_SW_18S.tsv") #South Wales 18S counts
SW_asv_fasta_18S <- read.fasta("Input_Data/HPC_processed_data/SW_18S/06_ASV_seqs_SW_18S.fasta") #South Wales 18S fasta
SW_asv_fasta_18S_df <- data.frame(ASV=names(SW_asv_fasta_18S), 
                                  Seqs=unlist(getSequence(SW_asv_fasta_18S, as.string=T))) #turn into data frame
SW_asv_fasta_18S_df$Seqs<- toupper(SW_asv_fasta_18S_df$Seqs) #upper case Seqs

SW_asv_count_CO1 <- read.table("Input_Data/HPC_processed_data/SW_CO1/06_ASV_counts_SW_CO1_names.tsv") #South Wales CO1 counts
SW_asv_fasta_CO1 <- read.fasta("Input_Data/HPC_processed_data/SW_CO1/06_ASV_seqs_SW_CO1_names.fasta") #South Wales CO1 fasta
SW_asv_fasta_CO1_df <- data.frame(ASV=names(SW_asv_fasta_CO1), 
                                  Seqs=unlist(getSequence(SW_asv_fasta_CO1, as.string=T))) #turn into data frame
SW_asv_fasta_CO1_df$Seqs<- toupper(SW_asv_fasta_CO1_df$Seqs) #upper case Seqs

#Northeast----
NE_asv_count_18S <- read.table("Input_Data/HPC_processed_data/NE_18S/06_ASV_counts_NE.tsv") #Northeast 18S counts
NE_asv_fasta_18S <- read.fasta("Input_Data/HPC_processed_data/NE_18S/06_ASV_seqs_NE.fasta")#Northeast 18S fasta
NE_asv_fasta_18S_df <- data.frame(ASV=names(NE_asv_fasta_18S), 
                                  Seqs=unlist(getSequence(NE_asv_fasta_18S, as.string=T))) #turn into data frame
NE_asv_fasta_18S_df$Seqs<- toupper(NE_asv_fasta_18S_df$Seqs) #upper case Seqs

NE_asv_count_CO1 <- read.table("Input_Data/HPC_processed_data/NE_CO1/06_ASV_counts.tsv") #Northeast CO1 counts
NE_asv_fasta_CO1 <- read.fasta("Input_Data/HPC_processed_data/NE_CO1/06_ASV_seqs.fasta")#Northeast CO1 fasta
NE_asv_fasta_CO1_df <- data.frame(ASV=names(NE_asv_fasta_CO1), 
                                  Seqs=unlist(getSequence(NE_asv_fasta_CO1, as.string=T))) #turn into data frame
NE_asv_fasta_CO1_df$Seqs<- toupper(NE_asv_fasta_CO1_df$Seqs) #upper case Seqs

#Cornwall----
CN_asv_count_18S <- read.table("Input_Data/HPC_processed_data/CN_18S/06_ASV_counts.tsv") #Cornwall 18S counts
CN_asv_fasta_18S <- read.fasta("Input_Data/HPC_processed_data/CN_18S/06_ASV_seqs.fasta")#Cornwall 18S fasta
CN_asv_fasta_18S_df <- data.frame(ASV=names(CN_asv_fasta_18S), 
                                  Seqs=unlist(getSequence(CN_asv_fasta_18S, as.string=T))) #turn into data frame
CN_asv_fasta_18S_df$Seqs<- toupper(CN_asv_fasta_18S_df$Seqs) #upper case Seqs

CN_asv_count_CO1 <- read.table("Input_Data/HPC_processed_data/CN_CO1/06_ASV_counts.tsv") #Cornwall CO1 counts
CN_asv_fasta_CO1 <- read.fasta("Input_Data/HPC_processed_data/CN_CO1/06_ASV_seqs.fasta")#Cornwall CO1 fasta
CN_asv_fasta_CO1_df <- data.frame(ASV=names(CN_asv_fasta_CO1), 
                                  Seqs=unlist(getSequence(CN_asv_fasta_CO1, as.string=T))) #turn into data frame
CN_asv_fasta_CO1_df$Seqs<- toupper(CN_asv_fasta_CO1_df$Seqs) #upper case Seqs

#Controls
controls_PhD2_asv_count_18S <- read.table("Input_Data/HPC_processed_data/Controls_18S/06_ASV_counts_Controls.tsv") #controls 18S counts
controls_PhD2_asv_fasta_18S <- read.fasta("Input_Data/HPC_processed_data/Controls_18S/06_ASV_seqs_Controls.fasta")#controls 18S fasta
controls_PhD2_asv_fasta_18S_df <- data.frame(ASV=names(controls_PhD2_asv_fasta_18S), 
                                             Seqs=unlist(getSequence(controls_PhD2_asv_fasta_18S, as.string=T))) #turn into data frame
controls_PhD2_asv_fasta_18S_df$Seqs<- toupper(controls_PhD2_asv_fasta_18S_df$Seqs) #upper case Seqs

controls_PhD2_asv_count_CO1 <- read.table("Input_Data/HPC_processed_data/Repeats_CO1/06_ASV_counts.tsv") #controls CO1 counts
controls_PhD2_asv_fasta_CO1 <- read.fasta("Input_Data/HPC_processed_data/Repeats_CO1/06_ASV_seqs.fasta")#controls  CO1 fasta
controls_PhD2_asv_fasta_CO1_df <- data.frame(ASV=names(controls_PhD2_asv_fasta_CO1), 
                                             Seqs=unlist(getSequence(controls_PhD2_asv_fasta_CO1, as.string=T))) #turn into data frame
controls_PhD2_asv_fasta_CO1_df$Seqs<- toupper(controls_PhD2_asv_fasta_CO1_df$Seqs) #upper case Seqs

Let’s take a look at an example of the two imported ASV files. Again, these shows the ASVs detected in Scotland derived from the CO1 gene.

str(SCH_asv_count_CO1) #counts
'data.frame':   25524 obs. of  69 variables:
 $ Adapter3616.SCH01.04rep: int  4093 1277 1446 285 247 8426 200 1132 74 76 ...
 $ Adapter3618.SCH04.09rep: int  6540 0 4951 13980 0 25 124 1022 141 31 ...
 $ Adapter3619.SCH07.02rep: int  4514 5476 44 0 7098 37 0 1062 0 2265 ...
 $ Adapter385.SCH01.01    : int  14226 34 0 3645 55 14877 72 3995 0 0 ...
 $ Adapter386.SCH01.02    : int  17167 97 57 128 29 11294 34 3222 0 0 ...
 $ Adapter387.SCH01.03    : int  11759 13 0 65 19 12901 0 2801 0 0 ...
 $ Adapter388.SCH01.04    : int  7043 1235 2119 409 116 10103 265 1971 212 99 ...
 $ Adapter389.SCH01.05    : int  6969 149 220 0 12746 8130 14 1907 0 0 ...
 $ Adapter390.SCH01.06    : int  1595 54 41322 2382 480 3344 25 578 0 0 ...
 $ Adapter391.SCH01.07    : int  5347 31 444 553 9 14428 4346 1909 0 82 ...
 $ Adapter392.SCH01.08    : int  3505 202 113 1132 9 17493 10475 1000 0 74 ...
 $ Adapter393.SCH01.09    : int  4292 57 152 1186 0 8626 3700 957 0 83 ...
 $ Adapter394.SCH01.C     : int  0 8 0 0 0 0 0 0 0 0 ...
 $ Adapter395.SCH02.01    : int  11959 62 120 715 0 392 1396 1826 0 98 ...
 $ Adapter396.SCH02.02    : int  2087 16 0 131 0 48 537 386 8 52 ...
 $ Adapter398.SCH02.04    : int  38 0 0 1782 0 0 0 0 56662 0 ...
 $ Adapter400.SCH02.06    : int  602 0 0 8866 0 40 0 162 24149 0 ...
 $ Adapter401.SCH02.C     : int  14 0 0 12 0 22 0 5 10 0 ...
 $ Adapter402.SCHNC1ex    : int  0 0 0 0 0 0 0 0 4 0 ...
 $ Adapter403.SCH03.01    : int  18895 304 5239 1427 75 417 470 3982 40 10 ...
 $ Adapter404.SCH03.02    : int  7478 22 3145 2473 34 185 13917 1091 0 0 ...
 $ Adapter405.SCH03.03    : int  17104 892 1097 250 19 725 569 3290 0 0 ...
 $ Adapter406.SCH03.04    : int  15268 24 2484 947 18 418 7 2957 259 0 ...
 $ Adapter407.SCH03.05    : int  7185 0 4943 2569 40 298 896 1131 673 0 ...
 $ Adapter408.SCH03.06    : int  13432 48 2614 572 59 633 241 2778 59 7 ...
 $ Adapter409.SCH03.07    : int  13391 63 91 70 52 1427 252 2817 0 197 ...
 $ Adapter410.SCH03.08    : int  15437 21 42 0 11 339 17 3480 0 56 ...
 $ Adapter411.SCH03.09    : int  11703 64 246 340 76 1711 242 2267 0 295 ...
 $ Adapter412.SCH03.C     : int  9 0 0 0 0 0 0 0 0 0 ...
 $ Adapter413.SCH04.01    : int  21451 6 247 99 43 221 2253 3042 0 299 ...
 $ Adapter414.SCH04.02    : int  37259 15 448 87 28561 340 7067 4422 0 226 ...
 $ Adapter416.SCH04.04    : int  46854 1890 2082 245 0 14 11 8926 0 0 ...
 $ Adapter417.SCH04.05    : int  26878 84 4754 5350 58 416 30879 4635 0 62 ...
 $ Adapter418.SCH04.06    : int  20521 6672 1237 0 1141 654 284 3087 0 161 ...
 $ Adapter419.SCH04.07    : int  5368 0 417 6578 0 0 0 778 0 5 ...
 $ Adapter420.SCH04.08    : int  10112 8 7201 11499 0 6 993 1698 81 68 ...
 $ Adapter421.SCH04.09    : int  10247 0 6344 18824 0 184 309 1865 382 132 ...
 $ Adapter422.SCH04.C     : int  45 0 9 0 21 0 9 13 10 0 ...
 $ Adapter423.SCHNC2ex    : int  48 0 10 0 23 9 0 5 0 0 ...
 $ Adapter424.SCH05.01    : int  11751 2887 69 91 131 455 117 2468 0 2658 ...
 $ Adapter425.SCH05.02    : int  8230 1134 57 0 77 272 33 1500 0 1177 ...
 $ Adapter426.SCH05.03    : int  10757 97 0 8 0 15 0 1994 0 116 ...
 $ Adapter427.SCH05.C     : int  0 0 0 0 0 0 0 0 0 0 ...
 $ Adapter428.SCH06.01    : int  6952 526 9164 238 3594 28 1040 942 0 1649 ...
 $ Adapter429.SCH06.02    : int  10309 26677 40 0 1339 30 969 1732 0 6878 ...
 $ Adapter430.SCH06.03    : int  6651 2433 92 0 25632 25 1550 972 0 6207 ...
 $ Adapter431.SCH06.04    : int  8922 14828 25 0 3810 42 77 1228 0 4183 ...
 $ Adapter432.SCH06.05    : int  5348 9687 17 0 2432 35 36 960 0 3236 ...
 $ Adapter433.SCH06.06    : int  9116 11166 8 0 3847 68 64 1360 0 7572 ...
 $ Adapter434.SCH06.C     : int  12 5 0 0 4 0 0 0 0 0 ...
 $ Adapter435.SCH07.01    : int  8558 23342 609 0 24425 61 117 1565 0 10786 ...
 $ Adapter436.SCH07.02    : int  11804 10739 138 0 14036 61 0 3911 0 4291 ...
 $ Adapter437.SCH07.03    : int  2289 2718 142 0 5587 24 106 528 0 6173 ...
 $ Adapter438.SCH07.C     : int  6 0 0 0 0 0 0 0 0 0 ...
 $ Adapter439.SCH08.01    : int  10664 77000 117 0 3881 222 92 2333 0 0 ...
 $ Adapter440.SCH08.02    : int  4825 60236 0 0 3213 49 0 775 0 0 ...
 $ Adapter441.SCH08.03    : int  2271 40980 38 0 2888 54 0 513 0 0 ...
 $ Adapter442.SCH08.04    : int  159 36 15855 12775 42 3 7671 57 0 0 ...
 $ Adapter443.SCH08.05    : int  15650 17873 38455 9310 460 61 2396 2530 0 0 ...
 $ Adapter444.SCH08.06    : int  11373 195 40361 818 17 58 213 2263 17 0 ...
 $ Adapter445.SCH08.07    : int  21058 66 6206 15798 11 178 19735 5069 1045 0 ...
 $ Adapter446.SCH08.08    : int  149 20 1213 37507 6 5 1803 59 924 0 ...
 $ Adapter447.SCH08.09    : int  21 0 0 453 0 0 0 0 25 0 ...
 $ Adapter448.SCH08.C     : int  0 0 0 0 0 0 0 0 4 0 ...
 $ Adapter449.SCHNC3ex    : int  31 296 0 0 45 0 0 9 0 0 ...
 $ Adapter450.SCHNCPCR    : int  0 0 105 0 0 0 51 0 0 0 ...
 $ Adapter451.SCHPC       : int  0 0 0 0 0 0 0 0 0 0 ...
 $ Adapter452.SCHPC2803   : int  0 0 0 0 0 0 0 0 0 0 ...
 $ Adapter453.SCHNC2803   : int  95 0 26 53 0 0 91 24 0 0 ...
head(SCH_asv_fasta_CO1_df) #sequences
    ASV
1 ASV_1
2 ASV_2
3 ASV_3
4 ASV_4
5 ASV_5
6 ASV_6
                                                                                                                                                                                                                                                                                                                                                              Seqs
1                                        ACTAAGTCATATTACTAGTCACTCAGGAGGTGCTGTAGATTTAGCTATTTTTAGTTTACACGTTTCAGGTGCAAGTAGTATTTTAGGTGCAATCAACTTTATTACTACCATCTTTAATATGCGTGGACCTGGATTATTAATGCATCGCTTACCTTTATTTGTATGGAGTGTTTTAATTACAGCGTTTTTACTTCTTCTCTCATTACCTGTACTTGCAGGTGCAATTACAATGTTACTAACTGATCGAAACTTTTCAACCAGTTTCTTTGACCCAAGTGGTGGAGGAGACCCTATTTTATATCAACATTTATTC
2                                        CCTTAGTGGTATTCAGGCTCACTCGGGGCCTTCTGTTGATTTAGCTATATTCAGTCTTCATCTCTCAGGTGCTGCTTCTATTTTAGGTGCTATAAATTTTATCACAACAATTTTTAATATGAGAGCTCCTGGTATGACAATGGATAGAGTACCTCTTTTTGTATGGTCTGTCTTAATCACAGCGTTTTTGTTACTGTTATCGCTTCCTGTTTTGGCAGGTGGTATTACAATGTTATTGACAGATCGTAACTTTAATACTACTTTCTTTGATCCGGCAGGTGGTGGTGATCCAGTATTGTATCAGCATTTATTT
3                                     ATTAAGCACTTCTTTCCTCAGTTTATCACCTTCAAGTACAGCTTTCATAGTCTTTGGATTATTAATGTCAGGTATATCCTCATCTCTCACATCTGTAAACTTTTGGACAACAATTATAAACATGAGATCTTATTATCTGACAATGAAGACTATGCCATTATTCCCTTGGAGCCTTTTGATAACTTCTGGAATGCTTTTATTAACATTACCAATCTTATCAGGAGCTCTTCTAATGGTCTTGGGTGATCTTCATTCTAATACACTTTTCTTTGATCCAATCTTTGGAGGAGATCCTATATTCTATCAACACTTATTT
4                                     ATTAAGCACTTCTTTCCTCAGTTTATCACCTTCAAGTACAGCTTTCATAGTCTTTGGATTATTAATGTCAGGTATATCCTCATCTCTCACATCTGTAAACTTTTGGACAACAATTATAAACATGAGATCTTATTATCTGACAATGAAGACTATGCCATTATTCCCTTGGAGCCTTTTGATAACTTCTGGAATGCTTTTATTAACATTACCAATCTTATCAGGAGCTCTTCTAATGGTCTTCGGTGATCTTCATTCTAATACACTTTTCTTTGATCCAATCTTTGGAGGAGATCCTATATTCTATCAACACTTATTT
5                                        ATTAAGTGGTATTCAAGCACACTCAGGGCCTTCAGTTGATTTAGCTATTTTTAGTTTACATTTATCTGGAGCGGCTTCAATTTTAGGAGCTATTAACTTTATTACTACAATCTTTAATATGCGTGCTCCTGGTATGACTATGGATAGATTACCTCTTTTTGTTTGGTCTGTTTTAATAACAGCATTCTTACTTTTATTATCCCTTCCTGTTTTAGCTGGTGGTATTACAATGCTTTTAACAGATAGAAATTTTAATACTACTTTTTTTGACCCTGCTGGTGGTGGTGATCCTGTATTATACCAACACTTATTT
6 ATTAAGTATTTTGGAACAAGCTATACCTGGATCGGGACTTGGAATGACTTTGTGGTTATTAAGTATGACACTGTTTATAGCTTCCTCATTAATTGGGGCGCTTAATTACATTGTTACAATTATTAACTTAAGAACCATTGGAATGAAAATGACAAGATTGCCACTTACTATTTGGGCATTCTTTGTAACTGCAATTTTAGGTGTACTTTCTTTTCCAGTATTAGTATCAGCAGTATTGTTGTTATTAATGGATAAGACTTTTGGAACAAGTTTCTACTTGTCTGATATCTTTATTGGAGGAGAAGCATTAGATGCATCTGGAGGTTCACCAATATTATACCAACATTTATTT

Metadata

Finally, let’s import any metadata associated to our samples.

sites <- read.csv("Input_Data/Metadata/eDNA_Site_Rockpool_Data_Oct2023.csv", na.strings=c("","NA"))
IDs_stageone <- read.csv("Input_Data/Metadata/sample_ID_matching_stageone.csv")
IDs_stagetwo <- read.csv("Input_Data/Metadata/sample_ID_matching_stagetwo.csv")

And let’s take a quick look at the metadata files too. You can see there are 63 variables which are associated to our samples.

str(sites)
'data.frame':   374 obs. of  63 variables:
 $ eventID              : chr  "PHD1-2023.03.23-Neg-bead" "PHD1-2023.03.29-Neg-PCRrep" "PHD1-2023.03.29-Pos-PCRrep" "PHD1-2022.06.12-SCH01-01" ...
 $ fieldID              : chr  "PHD1-NCbead" "PHD1-NCrep" "PHD1-PCrep" "PHD1-SCH01-01" ...
 $ projectID            : chr  "PHD1" "PHD1" "PHD1" "PHD1" ...
 $ localityID           : chr  NA NA NA "SCH01" ...
 $ sampleID             : chr  NA NA NA "1" ...
 $ sampleType           : chr  "lab-negative-control" "lab-negative-control" "lab-positive-control" "sample" ...
 $ controlCheck         : chr  "control" "control" "positive" "sample" ...
 $ negCheckLogical      : logi  TRUE TRUE FALSE FALSE FALSE FALSE ...
 $ pairedRepLogical     : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
 $ batch_extraction     : int  NA NA NA 1 1 1 1 1 1 1 ...
 $ batch_PCR_CO1        : int  1 1 1 2 2 2 2 1 2 2 ...
 $ plate_col_CO1        : int  7 8 9 1 1 1 1 8 1 1 ...
 $ plate_row_CO1        : chr  "H" "G" "D" "A" ...
 $ batch_PCR_18S        : int  NA 3 3 4 4 4 4 3 4 4 ...
 $ plate_col_18S        : int  NA 8 9 1 1 1 1 8 1 1 ...
 $ plate_row_18S        : chr  NA "D" "A" "A" ...
 $ date_extraction      : chr  NA NA NA "24.02.2023" ...
 $ date_amplified_CO1   : chr  "22.03.2023" "29.03.2023" "29.03.2023" "28.03.2023" ...
 $ date_amplified_18S   : chr  NA "29.03.2023" "29.03.2023" "27.03.2023" ...
 $ sample_18S           : chr  NA "S60" "S65" "S66" ...
 $ sample_CO1           : chr  "Adapter3608.NCbead" "Adapter3615.NCPCRrep" "Adapter3620.PCrep" "Adapter385.SCH01.01" ...
 $ COUNT                : int  1 2 2 2 2 2 2 2 2 2 ...
 $ dna_concentration_CO1: num  4.63 28.76 73.22 82.54 70.27 ...
 $ dna_concentration_18S: num  NA 46.3 81.6 55.4 37 ...
 $ continent            : chr  NA NA NA "Europe" ...
 $ country              : chr  NA NA NA "Scotland" ...
 $ county               : chr  NA NA NA "Sutherland" ...
 $ waterBody            : chr  NA NA NA "rocky" ...
 $ verbatimLocality     : chr  NA NA NA "Scourie" ...
 $ exposure             : chr  NA NA NA "Exposed" ...
 $ weather              : chr  NA NA NA "moderate rain, strong winds, very cloudy" ...
 $ tide                 : chr  NA NA NA "outgoing" ...
 $ lowWater             : chr  NA NA NA "12:23" ...
 $ decimalLongitude     : num  NA NA NA -5.17 -5.17 ...
 $ decimalLatitude      : num  NA NA NA 58.4 58.4 ...
 $ recordedBy           : chr  NA NA NA "Dina-Leigh Simons; Nova Mieszkowska" ...
 $ year                 : int  NA NA NA 2022 2022 2022 2022 2022 2022 2022 ...
 $ month                : int  NA NA NA 6 6 6 6 6 6 6 ...
 $ day                  : int  NA NA NA 12 12 12 12 12 12 12 ...
 $ eventTime            : chr  NA NA NA "09:31" ...
 $ samplingProtocol     : chr  NA NA NA "Sterivex-0.22" ...
 $ pumpType             : chr  NA NA NA "Syringe 60mL, sealant gun" ...
 $ repVol..mL.          : int  NA NA NA 1000 1000 800 1000 1000 1000 1000 ...
 $ algaeCover.          : int  NA NA NA 0 5 60 90 90 90 95 ...
 $ remarks              : chr  NA NA NA "Filtered on shore" ...
 $ daysBeforefreeze     : int  NA NA NA 9 9 9 9 9 9 9 ...
 $ preservation         : chr  NA NA NA "EtOH" ...
 $ type                 : chr  NA NA NA "Rockpool" ...
 $ shorePosition        : chr  NA NA NA "High" ...
 $ rockpoolarea.cm.2.   : num  NA NA NA 7443 23218 ...
 $ depth1               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ depth2               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averageDepth..cm.    : num  NA NA NA 25 19.1 13.9 1100 1100 24.7 25.6 ...
 $ rockpoolVol.m.3.     : num  NA NA NA 0.186 0.444 ...
 $ pH1                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ pH2                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averagePH            : num  NA NA NA 8.59 8.78 8.47 8.63 8.63 9.54 8.84 ...
 $ temp1                : chr  NA NA NA NA ...
 $ temp2                : chr  NA NA NA NA ...
 $ averageTemp          : num  NA NA NA 13 13.6 ...
 $ siteImage            : chr  NA NA NA "IMG_SCH01-01.jpeg" ...
 $ rockType             : chr  NA NA NA "metamorphic" ...
 $ rockFold             : chr  NA NA NA NA ...

We also have some data to help tidy up sample IDs later in the pipeline.

head(IDs_stageone) #labels
            sample_ID sample_18S           sample_CO1
1 PHD1-SCHNC-PCR_1703       <NA>  Adapter450.SCHNCPCR
2     PHD1-SCHPC_1703       <NA>     Adapter451.SCHPC
3      PHD1-SCHNC2803       <NA> Adapter453.SCHNC2803
4      PHD1-SCHPC2803       <NA> Adapter452.SCHPC2803
5         PHD1-NCbead       <NA>   Adapter3608.NCbead
6  PHD1-SWNC_PCR_2203       <NA>  Adapter3607.SWNCPCR

Data wrangling to create a single data set

We have lots of different files here which need to be manipulated into one single data frame for each primer. A few steps are required to achieve this.

Merge taxonomic assignments and ASV information

#Scotland----
SCH_asv_18S_merged <- merge(SCH_asv_fasta_18S_df, SCH_asv_count_18S, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
SCH_taxa_18S <- full_join(SCH_18S_taxa, SCH_asv_18S_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

SCH_asv_CO1_merged <- merge(SCH_asv_fasta_CO1_df, SCH_asv_count_CO1, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
SCH_taxa_CO1 <- full_join(SCH_CO1_taxa, SCH_asv_CO1_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

#North Wales----
NW_asv_18S_merged <- merge(NW_asv_fasta_18S_df, NW_asv_count_18S, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
NW_taxa_18S <- full_join(NW_18S_taxa, NW_asv_18S_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

NW_asv_CO1_merged <- merge(NW_asv_fasta_CO1_df, NW_asv_count_CO1, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
NW_taxa_CO1 <- full_join(NW_CO1_taxa, NW_asv_CO1_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

#South Wales----
SW_asv_18S_merged <- merge(SW_asv_fasta_18S_df, SW_asv_count_18S, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
SW_taxa_18S <- full_join(SW_18S_taxa, SW_asv_18S_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

SW_asv_CO1_merged <- merge(SW_asv_fasta_CO1_df, SW_asv_count_CO1, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
SW_taxa_CO1 <- full_join(SW_CO1_taxa, SW_asv_CO1_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

#Northeast----
NE_asv_18S_merged <- merge(NE_asv_fasta_18S_df, NE_asv_count_18S, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
NE_taxa_18S <- full_join(NE_18S_taxa, NE_asv_18S_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

NE_asv_CO1_merged <- merge(NE_asv_fasta_CO1_df, NE_asv_count_CO1, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
NE_taxa_CO1 <- full_join(NE_CO1_taxa, NE_asv_CO1_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

#Cornwall----
CN_asv_18S_merged <- merge(CN_asv_fasta_18S_df, CN_asv_count_18S, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
CN_taxa_18S <- full_join(CN_18S_taxa, CN_asv_18S_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

CN_asv_CO1_merged <- merge(CN_asv_fasta_CO1_df, CN_asv_count_CO1, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
CN_taxa_CO1 <- full_join(CN_CO1_taxa, CN_asv_CO1_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

#Controls----
Controls_asv_18S_merged <- merge(controls_PhD2_asv_fasta_18S_df, controls_PhD2_asv_count_18S, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
Controls_taxa_18S <- full_join(Controls_18S_taxa, Controls_asv_18S_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

Controls_asv_CO1_merged <- merge(controls_PhD2_asv_fasta_CO1_df, controls_PhD2_asv_count_CO1, by.x = "Seqs", by.y = "row.names") #add ASVs to count data
Controls_taxa_CO1 <- full_join(Controls_CO1_taxa, Controls_asv_CO1_merged, by = "ASV") #full_join keeps ASVs which didn't get assigned, left_join would remove unassigned

Remove undetermined sequences in 18S data

Sequences that were unable to be assigned to a specific sample in the 18S are stored under the variable ‘S0’. We want to remove those sequences from our data.

drop <- c("S0") # set which variable we want to remove (undetermined in MiniSeq run)

SCH_taxa_18S <- SCH_taxa_18S[,!(names(SCH_taxa_18S) %in% drop)]
NW_taxa_18S <- NW_taxa_18S[,!(names(NW_taxa_18S) %in% drop)]
SW_taxa_18S <- SW_taxa_18S[,!(names(SW_taxa_18S) %in% drop)] 
NE_taxa_18S <- NE_taxa_18S[,!(names(NE_taxa_18S) %in% drop)]
CN_taxa_18S <- CN_taxa_18S[,!(names(CN_taxa_18S) %in% drop)]
Controls_taxa_18S <- Controls_taxa_18S[,!(names(Controls_taxa_18S) %in% drop)]

Convert to long format

Here, we flip the data sets into a long format and add a region variable.

#Scotland----
flip_SCH_18S <- gather(SCH_taxa_18S, sample, reads, S66:S132) 
flip_SCH_18S$region <- "Scotland"

flip_SCH_CO1 <- gather(SCH_taxa_CO1, sample, reads, Adapter3616.SCH01.04rep:Adapter453.SCHNC2803) #this is not number order, this is first and last column
flip_SCH_CO1$region <- "Scotland"

#North Wales----
flip_NW_18S <- gather(NW_taxa_18S, sample, reads, S1:S51) 
flip_NW_18S$region <- "North Wales"

flip_NW_CO1 <- gather(NW_taxa_CO1, sample, reads, X1.NW01.01:X9.NW02.06) #this is not number order, this is first and last column
flip_NW_CO1$region <- "North Wales"

#South Wales----
flip_SW_18S <- gather(SW_taxa_18S, sample, reads, S60:S54) 
flip_SW_18S$region <- "South Wales"

flip_SW_CO1 <- gather(SW_taxa_CO1, sample, reads, Adapter3553.SW01.01:Adapter3620.PCrep) #this is not number order, this is first and last column
flip_SW_CO1$region <- "South Wales"

#Northeast----
flip_NE_18S <- gather(NE_taxa_18S, sample, reads, S73:S123) 
flip_NE_18S$region <- "Northeast England"

flip_NE_CO1 <- gather(NE_taxa_CO1, sample, reads, X100.NE05.02:X99.NE05.01) #this is not number order, this is first and last column
flip_NE_CO1$region <- "Northeast England"

#Cornwall----
flip_CN_18S <- gather(CN_taxa_18S, sample, reads, S133:S183) 
flip_CN_18S$region <- "Cornwall"

flip_CN_CO1 <- gather(CN_taxa_CO1, sample, reads, X115.CN01.01:X192.CN01.02rep) #this is not number order, this is first and last column
flip_CN_CO1$region <- "Cornwall"

#Controls----
flip_controls_18S <- gather(Controls_taxa_18S, sample, reads, S34:S61) #this is not number order, this is first and last column
flip_controls_18S$region <- "Varied"

flip_controls_CO1 <- gather(Controls_taxa_CO1, sample, reads, X173.SCH02.03:X195.minusVEpcr) #this is not number order, this is first and last column
flip_controls_CO1$region <- "Varied"

Let’s take a look at the long format for Scotland CO1. We now have a long format data set with ASVs, taxonomy, sequences, sample names, number of reads and region variables.

head(flip_SCH_CO1)
        ASV                taxonomy
1   ASV_820 Paramoeba pemaquidensis
2 ASV_18576      Vexillifera kereti
3 ASV_22679      Vexillifera kereti
4   ASV_280       Parvamoeba rugata
5 ASV_10580       Parvamoeba rugata
6 ASV_20723       Parvamoeba rugata
                                                                                                                                                                                                                                                                                                                       Seqs
1 ATTATCTAGTGTAGTTGCACATTCAACTCCTTCCGTAGATTTAGCTATATTTAGTTTACATTTAGCAGGTATAGCATCAATTGCAGGATCTATTAATTATATTACAACTATTTTTAATATGAGAGTTGCTAAATATGATATGTTTAGATTACCTTTATTTATTTGAGGTATGCTTATTACTGCTTATTTATTAGTTTTTACTTTACCTGTTTTAGCTGGTGCTATCACTATGCTATTAACTGATAGAAATTTTAATACTTCTTTTTTTGATCCCGCTGGAGGTGGAGATCCTATACTATATCAACATTTATTT
2 ATTATCTAGTATAATTGCGCATTCTGGTGGTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAGCAGGTATTTCGTCATTATTAGGTGCTATTAATTTTATTACAACTATTTTTAATATGAGAGCAAATAATTTTAGCATATATAAAATGCCTTTATTTGTTTGAGCAGTATTAATTACAGCTTTTTTATTATTATTATCATTACCTGTATTAGCAGGAGCTATTACTATGCTTTTAACTGATAGAAATTTTAATACTACTTTTTTTGACCCAGCAGGAGGTGGTGATCCTATATTGTATCAACATTTATTT
3 ATTATCTAGTATAATTGCGCATTCTGGTGGTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAGCAGGTATTTCGTCATTATTAGGTGCTATTAATTTTATTACAACTATTTTTAATATGAGAGCAAATAATTTTAGTATATATAAAATGCCTTTATTTGTTTGAGCAGTATTAATTACAGCTTTTTTATTATTATTATCATTACCTGTATTAGCTGGAGCTATTACTATGCTTTTAACTGATAGAAATTTTAATACTACTTTTTTTGACCCAGCAGGAGGAGGTGATCCTATATTGTATCAACATTTATTT
4 TTTATCGGGTATAGAAGCGCATTCTGGTGGATCTGTAGATTTAGCAATTTTTAGTTTACATTTAGCAGGAGCATCTTCTTTATTAGGAGCAATAAATTTTATTACTACTGTCTTTAATATGAGAGCACCTAATTTAGAAATGCATAAATTACCTTTATTTGTATGAGCTATTTTAATTACAGCTTTTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATAACTATGCTTTTAACTGATCGTAATTTTAATACTACTTTTTTTGATCCAGCTGGTGGTGGTGATCCAATATTGTATCAGCATTTATTT
5 TTTATCTGGTATAGAAGCACATTCTGGTGGATCTGTAGATTTAGCAATTTTTAGTTTACATTTAGCAGGAGCATCTTCTTTATTAGGAGCAATAAATTTTATTACTACTGTTTTTAATATGAGAGCACCTAATTTAGAAATGCATAAATTACCTTTATTTGTTTGAGCTATTTTAATCACAGCTTTTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATAACTATGCTTTTAACTGATCGTAATTTTAATACTACTTTTTTTGATCCAGCTGGTGGTGGTGATCCAATATTGTATCAGCATTTGTTT
6 TTTATCGGGTATAGAAGCGCATTCTGGTGGATCTGTAGATTTAGCAATTTTTAGTTTACATTTAGCAGGAGCATCTTCTTTATTAGGAGCAATAAATTTTATTACTACTGTCTTTAATATGAGAGCACCTAATTTAGAAATGCATAAATTACCTTTATTTGTATGAGCTATTTTAATTACAGCTTTTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATAACTATGCTTTTAACTGATCGTAATTTTAATACTACTTTTTTTGATCCAGCTGGTGGTGGTGATCCAATATTGTATCAGCATTTATTT
                   sample reads   region
1 Adapter3616.SCH01.04rep    13 Scotland
2 Adapter3616.SCH01.04rep     2 Scotland
3 Adapter3616.SCH01.04rep     0 Scotland
4 Adapter3616.SCH01.04rep     0 Scotland
5 Adapter3616.SCH01.04rep    14 Scotland
6 Adapter3616.SCH01.04rep     0 Scotland

Join data frames

We will merge our data in multiple stages: first by sequencing run, then by gene, and finally, we will perform the final join. Once we have our single data frame, we’ll add in our metadata.

Our data was derived from multiple sequences runs. Therefore, we are going to join the data in the same sequencing run first. This means we can correctly match IDs we want to sample names.

# Merge stage-one locations (SCH and SW) and add IDs
full_stageone_18S <-rbind(flip_SCH_18S, flip_SW_18S) %>% 
  dplyr::rename(sample_18S = sample) %>% #rename sample column to match
  full_join(IDs_stageone, by = "sample_18S")

full_stageone_18S$region <- as.factor(full_stageone_18S$region)

full_stageone_CO1 <-rbind(flip_SCH_CO1, flip_SW_CO1) %>% 
  dplyr::rename(sample_CO1 = sample) %>% #rename sample column to match
  full_join(IDs_stageone, by = "sample_CO1")

full_stageone_CO1$region <- as.factor(full_stageone_CO1$region)

# Merge stage-two locations (controls, CN, NE, NW)
full_stagetwo_18S <-rbind(flip_controls_18S, flip_CN_18S, flip_NE_18S, flip_NW_18S) %>% 
  dplyr::rename(sample_18S = sample) %>% 
  left_join(IDs_stagetwo, by = "sample_18S")

full_stagetwo_18S$region <- as.factor(full_stagetwo_18S$region)

full_stagetwo_CO1 <-rbind(flip_controls_CO1, flip_CN_CO1, flip_NE_CO1, flip_NW_CO1) %>%
  dplyr::rename(sample_CO1 = sample) %>% 
  full_join(IDs_stagetwo, by = "sample_CO1")

full_stagetwo_CO1$region <- as.factor(full_stagetwo_CO1$region)

Now we join data sets by primer and add primer variable. This will leave us with two main data sets, one for 18S and one for CO1. We also want to make sure out wrangling worked as expected by checking there are no duplicate rows.

full_18S <- rbind(full_stageone_18S, full_stagetwo_18S) #18s
full_18S$primer <- "18S"
any(duplicated(full_18S)) #check for duplicates - should be false
[1] FALSE
full_CO1 <- rbind(full_stageone_CO1, full_stagetwo_CO1) #CO1
full_CO1$primer <- "CO1"
any(duplicated(full_CO1)) #check for duplicates - should be false
[1] FALSE

Finally, we join the two primer data sets into a single data set.

eDNA_ASVs_long <- rbind(full_18S, full_CO1)
any(duplicated(eDNA_ASVs_long)) #check for duplicates - should be false (this may take a minute or so)
[1] FALSE

Let’s now add in our metadata and do some final tweaks to sample names.

eDNA_long_data <- eDNA_ASVs_long %>% 
  subset(select = -c(sample_18S, sample_CO1)) %>% 
  dplyr::rename(fieldID = sample_ID)
eDNA_long_data <- full_join(eDNA_long_data, sites, by = "fieldID")

eDNA_long_data$fullID = paste(eDNA_long_data$fieldID, eDNA_long_data$primer, sep="_") #adds CO1 or 18S onto the end of the fieldID for further analyses

Great - we now have a single long data set with all ASV across samples and genes, as well as associated metadata.

str(eDNA_long_data)
'data.frame':   7012768 obs. of  70 variables:
 $ ASV                  : chr  "ASV_15" "ASV_16" "ASV_25" "ASV_32" ...
 $ taxonomy             : chr  "Eukaryota" "Eukaryota" "Eukaryota" "Eukaryota" ...
 $ Seqs                 : chr  "ATAACGAACGAGACCTTAACCTGCTAAATAGTCAGGCCGGCTTTGGCTGGTCGTCGACTTCTTAGAGGGACTATTGGCGTTTAGCCAATGGAAGTTTGAG" "TTAACGAACGAGACCTCAGCCTGCTAAATAGTTGGACCCTACTCTTAGGGCCACAACTTCTTAGAGGGACTATGTGCGTGTAGCACGTGGAAGTTTGAG" "TTAACGAACGAGACCTCAGCCTGCTAAATAGTTGTACGCTACTCTTAGCGCAGCAACTTCTTAGAGGGACTATTGGCGTTTAGCCAATGGAAGTTTGAG" "TTAACGAACGAGACCTTAACCTGCTAAATAGTTACACTTAACTTCGGTTATGTGGGCAACTTCTTAGAGGGACTTTGTGTGTTTAACGCAAGGAAGTTTGAG" ...
 $ reads                : int  12 69 1743 138 843 0 192 802 0 33 ...
 $ region               : Factor w/ 6 levels "Scotland","South Wales",..: 1 1 1 1 1 1 1 1 1 1 ...
 $ fieldID              : chr  "PHD1-SCH01-01" "PHD1-SCH01-01" "PHD1-SCH01-01" "PHD1-SCH01-01" ...
 $ primer               : chr  "18S" "18S" "18S" "18S" ...
 $ eventID              : chr  "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" ...
 $ projectID            : chr  "PHD1" "PHD1" "PHD1" "PHD1" ...
 $ localityID           : chr  "SCH01" "SCH01" "SCH01" "SCH01" ...
 $ sampleID             : chr  "1" "1" "1" "1" ...
 $ sampleType           : chr  "sample" "sample" "sample" "sample" ...
 $ controlCheck         : chr  "sample" "sample" "sample" "sample" ...
 $ negCheckLogical      : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
 $ pairedRepLogical     : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
 $ batch_extraction     : int  1 1 1 1 1 1 1 1 1 1 ...
 $ batch_PCR_CO1        : int  2 2 2 2 2 2 2 2 2 2 ...
 $ plate_col_CO1        : int  1 1 1 1 1 1 1 1 1 1 ...
 $ plate_row_CO1        : chr  "A" "A" "A" "A" ...
 $ batch_PCR_18S        : int  4 4 4 4 4 4 4 4 4 4 ...
 $ plate_col_18S        : int  1 1 1 1 1 1 1 1 1 1 ...
 $ plate_row_18S        : chr  "A" "A" "A" "A" ...
 $ date_extraction      : chr  "24.02.2023" "24.02.2023" "24.02.2023" "24.02.2023" ...
 $ date_amplified_CO1   : chr  "28.03.2023" "28.03.2023" "28.03.2023" "28.03.2023" ...
 $ date_amplified_18S   : chr  "27.03.2023" "27.03.2023" "27.03.2023" "27.03.2023" ...
 $ sample_18S           : chr  "S66" "S66" "S66" "S66" ...
 $ sample_CO1           : chr  "Adapter385.SCH01.01" "Adapter385.SCH01.01" "Adapter385.SCH01.01" "Adapter385.SCH01.01" ...
 $ COUNT                : int  2 2 2 2 2 2 2 2 2 2 ...
 $ dna_concentration_CO1: num  82.5 82.5 82.5 82.5 82.5 ...
 $ dna_concentration_18S: num  55.4 55.4 55.4 55.4 55.4 ...
 $ continent            : chr  "Europe" "Europe" "Europe" "Europe" ...
 $ country              : chr  "Scotland" "Scotland" "Scotland" "Scotland" ...
 $ county               : chr  "Sutherland" "Sutherland" "Sutherland" "Sutherland" ...
 $ waterBody            : chr  "rocky" "rocky" "rocky" "rocky" ...
 $ verbatimLocality     : chr  "Scourie" "Scourie" "Scourie" "Scourie" ...
 $ exposure             : chr  "Exposed" "Exposed" "Exposed" "Exposed" ...
 $ weather              : chr  "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" ...
 $ tide                 : chr  "outgoing" "outgoing" "outgoing" "outgoing" ...
 $ lowWater             : chr  "12:23" "12:23" "12:23" "12:23" ...
 $ decimalLongitude     : num  -5.17 -5.17 -5.17 -5.17 -5.17 ...
 $ decimalLatitude      : num  58.4 58.4 58.4 58.4 58.4 ...
 $ recordedBy           : chr  "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" ...
 $ year                 : int  2022 2022 2022 2022 2022 2022 2022 2022 2022 2022 ...
 $ month                : int  6 6 6 6 6 6 6 6 6 6 ...
 $ day                  : int  12 12 12 12 12 12 12 12 12 12 ...
 $ eventTime            : chr  "09:31" "09:31" "09:31" "09:31" ...
 $ samplingProtocol     : chr  "Sterivex-0.22" "Sterivex-0.22" "Sterivex-0.22" "Sterivex-0.22" ...
 $ pumpType             : chr  "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" ...
 $ repVol..mL.          : int  1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 ...
 $ algaeCover.          : int  0 0 0 0 0 0 0 0 0 0 ...
 $ remarks              : chr  "Filtered on shore" "Filtered on shore" "Filtered on shore" "Filtered on shore" ...
 $ daysBeforefreeze     : int  9 9 9 9 9 9 9 9 9 9 ...
 $ preservation         : chr  "EtOH" "EtOH" "EtOH" "EtOH" ...
 $ type                 : chr  "Rockpool" "Rockpool" "Rockpool" "Rockpool" ...
 $ shorePosition        : chr  "High" "High" "High" "High" ...
 $ rockpoolarea.cm.2.   : num  7443 7443 7443 7443 7443 ...
 $ depth1               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ depth2               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averageDepth..cm.    : num  25 25 25 25 25 25 25 25 25 25 ...
 $ rockpoolVol.m.3.     : num  0.186 0.186 0.186 0.186 0.186 ...
 $ pH1                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ pH2                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averagePH            : num  8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 ...
 $ temp1                : chr  NA NA NA NA ...
 $ temp2                : chr  NA NA NA NA ...
 $ averageTemp          : num  13 13 13 13 13 13 13 13 13 13 ...
 $ siteImage            : chr  "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" ...
 $ rockType             : chr  "metamorphic" "metamorphic" "metamorphic" "metamorphic" ...
 $ rockFold             : chr  NA NA NA NA ...
 $ fullID               : chr  "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" ...

Cleaning taxonomic names

Now we have our data, we need to tidy up our taxonomic names and get more information on the taxa we’ve detected.

Remove ambiguous names

We first remove any occurrences where the taxonomic matches certain ambiguous phrases. These assignment tell us nothing about the organism we’ve detected, so it’s best to remove them.

# Define the unassigned phrases
unassigned_phrases <- c(
  "uncultured",
  "Uncultured",
  "unclassified",
  "Unclassified",
  "NCBI",
  "pseudo",
  "Pseudo",
  "Not assigned",
  "not assigned",
  "SAR",
  "sar",
  "cellular",
  "Cellular",
  "environmental",
  "Environmental",
  "eukaryote",
  "Eukaryote",
  "eukaryota",
  "Eukaryota"
)

# calculate percentage of unassigned
total_asvs <- nrow(eDNA_long_data) # Count total ASVs before filtering
unassigned_asvs <- eDNA_long_data[grepl(paste(unassigned_phrases, collapse = "|"), eDNA_long_data$taxonomy), ]
removed_asvs <- nrow(unassigned_asvs) # Count ASVs that will be removed
percentage_removed <- (removed_asvs / total_asvs) * 100 # Calculate percentage removed
cat("Percentage of ASVs removed:", round(percentage_removed, 2), "%\n") #print
Percentage of ASVs removed: 1.59 %
# Perform the filtering
eDNA_long_data_cleaning <- eDNA_long_data[!grepl(paste(unassigned_phrases, collapse = "|"), eDNA_long_data$taxonomy), ] %>%
  drop_na(taxonomy)

Using clean_names() in janitor package

We often get random spaces or phrases we don’t want in our taxonomic names. We can use the janitor package to clean our taxonomic names.

names <- unique(eDNA_long_data_cleaning$taxonomy) #get all unique names from the data
cleaned_names <- clean_names(names) #clean names using janitor package in tidyverse
names_together <- data.frame(names, cleaned_names) %>% 
  dplyr::rename(taxonomy = names, taxonomy_clean = cleaned_names) %>% #join cleaned names next to original
  mutate(taxonomy_clean = gsub(' cf','', taxonomy_clean)) %>% #remove cfs which function didn't remove
  mutate(taxonomy_clean = gsub('cf ','', taxonomy_clean)) #remove cfs which function didn't remove

eDNA_long_data_cleaned <- full_join(names_together, eDNA_long_data_cleaning)

We should now have a variable added to our data set called taxonomy_clean. We will use this variable as the taxonomic name moving forward.

str(eDNA_long_data_cleaned)
'data.frame':   841939 obs. of  71 variables:
 $ taxonomy             : chr  "Amoebozoa" "Amoebozoa" "Amoebozoa" "Amoebozoa" ...
 $ taxonomy_clean       : chr  "amoebozoa" "amoebozoa" "amoebozoa" "amoebozoa" ...
 $ ASV                  : chr  "ASV_3057" "ASV_3512" "ASV_3942" "ASV_4258" ...
 $ Seqs                 : chr  "TTAACGAACGAGACCTTAACCTATTAAATAGTTGCGCGAACTTGAATCATGCGTCATGTTATCTTCGGATAATGTTTCCTCCATGGTTCTATCGTTCTGTGAAAACTTCTT"| __truncated__ "ATAACGAACGAGACCTCAGCCTGCTAACTAGTATGCCTTAGCCTTGTTTTCTTGGCTAAGGAATTTATTGAATATACTTCTTAGAGGGACTATCCGTGTCTAGCGGGTGGAAGTTTGAG" "TTAACGAACGAGACCTTAACCTATTAAATAGTTGCGCGAACTTGAATCATGCGTCAGTTCGTCTTTTGGGCGGACTGTCCTCCATGGTTCTATCGTTCTGTGAAAACTTCT"| __truncated__ "TTAACGAACGAGACCTTAACCTATTAAATAGTTGCGCGAACTTGAATCATGCGTCAGTTCGTCCTTCGTGGGCGAGCTGTCCTCCATGGTTCTATCGTTCTGTGAAAACTT"| __truncated__ ...
 $ reads                : int  0 0 0 0 0 0 0 0 0 0 ...
 $ region               : Factor w/ 6 levels "Scotland","South Wales",..: 1 1 1 1 1 1 1 1 1 1 ...
 $ fieldID              : chr  "PHD1-SCH01-01" "PHD1-SCH01-01" "PHD1-SCH01-01" "PHD1-SCH01-01" ...
 $ primer               : chr  "18S" "18S" "18S" "18S" ...
 $ eventID              : chr  "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" ...
 $ projectID            : chr  "PHD1" "PHD1" "PHD1" "PHD1" ...
 $ localityID           : chr  "SCH01" "SCH01" "SCH01" "SCH01" ...
 $ sampleID             : chr  "1" "1" "1" "1" ...
 $ sampleType           : chr  "sample" "sample" "sample" "sample" ...
 $ controlCheck         : chr  "sample" "sample" "sample" "sample" ...
 $ negCheckLogical      : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
 $ pairedRepLogical     : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
 $ batch_extraction     : int  1 1 1 1 1 1 1 1 1 1 ...
 $ batch_PCR_CO1        : int  2 2 2 2 2 2 2 2 2 2 ...
 $ plate_col_CO1        : int  1 1 1 1 1 1 1 1 1 1 ...
 $ plate_row_CO1        : chr  "A" "A" "A" "A" ...
 $ batch_PCR_18S        : int  4 4 4 4 4 4 4 4 4 4 ...
 $ plate_col_18S        : int  1 1 1 1 1 1 1 1 1 1 ...
 $ plate_row_18S        : chr  "A" "A" "A" "A" ...
 $ date_extraction      : chr  "24.02.2023" "24.02.2023" "24.02.2023" "24.02.2023" ...
 $ date_amplified_CO1   : chr  "28.03.2023" "28.03.2023" "28.03.2023" "28.03.2023" ...
 $ date_amplified_18S   : chr  "27.03.2023" "27.03.2023" "27.03.2023" "27.03.2023" ...
 $ sample_18S           : chr  "S66" "S66" "S66" "S66" ...
 $ sample_CO1           : chr  "Adapter385.SCH01.01" "Adapter385.SCH01.01" "Adapter385.SCH01.01" "Adapter385.SCH01.01" ...
 $ COUNT                : int  2 2 2 2 2 2 2 2 2 2 ...
 $ dna_concentration_CO1: num  82.5 82.5 82.5 82.5 82.5 ...
 $ dna_concentration_18S: num  55.4 55.4 55.4 55.4 55.4 ...
 $ continent            : chr  "Europe" "Europe" "Europe" "Europe" ...
 $ country              : chr  "Scotland" "Scotland" "Scotland" "Scotland" ...
 $ county               : chr  "Sutherland" "Sutherland" "Sutherland" "Sutherland" ...
 $ waterBody            : chr  "rocky" "rocky" "rocky" "rocky" ...
 $ verbatimLocality     : chr  "Scourie" "Scourie" "Scourie" "Scourie" ...
 $ exposure             : chr  "Exposed" "Exposed" "Exposed" "Exposed" ...
 $ weather              : chr  "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" ...
 $ tide                 : chr  "outgoing" "outgoing" "outgoing" "outgoing" ...
 $ lowWater             : chr  "12:23" "12:23" "12:23" "12:23" ...
 $ decimalLongitude     : num  -5.17 -5.17 -5.17 -5.17 -5.17 ...
 $ decimalLatitude      : num  58.4 58.4 58.4 58.4 58.4 ...
 $ recordedBy           : chr  "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" ...
 $ year                 : int  2022 2022 2022 2022 2022 2022 2022 2022 2022 2022 ...
 $ month                : int  6 6 6 6 6 6 6 6 6 6 ...
 $ day                  : int  12 12 12 12 12 12 12 12 12 12 ...
 $ eventTime            : chr  "09:31" "09:31" "09:31" "09:31" ...
 $ samplingProtocol     : chr  "Sterivex-0.22" "Sterivex-0.22" "Sterivex-0.22" "Sterivex-0.22" ...
 $ pumpType             : chr  "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" ...
 $ repVol..mL.          : int  1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 ...
 $ algaeCover.          : int  0 0 0 0 0 0 0 0 0 0 ...
 $ remarks              : chr  "Filtered on shore" "Filtered on shore" "Filtered on shore" "Filtered on shore" ...
 $ daysBeforefreeze     : int  9 9 9 9 9 9 9 9 9 9 ...
 $ preservation         : chr  "EtOH" "EtOH" "EtOH" "EtOH" ...
 $ type                 : chr  "Rockpool" "Rockpool" "Rockpool" "Rockpool" ...
 $ shorePosition        : chr  "High" "High" "High" "High" ...
 $ rockpoolarea.cm.2.   : num  7443 7443 7443 7443 7443 ...
 $ depth1               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ depth2               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averageDepth..cm.    : num  25 25 25 25 25 25 25 25 25 25 ...
 $ rockpoolVol.m.3.     : num  0.186 0.186 0.186 0.186 0.186 ...
 $ pH1                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ pH2                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averagePH            : num  8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 ...
 $ temp1                : chr  NA NA NA NA ...
 $ temp2                : chr  NA NA NA NA ...
 $ averageTemp          : num  13 13 13 13 13 13 13 13 13 13 ...
 $ siteImage            : chr  "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" ...
 $ rockType             : chr  "metamorphic" "metamorphic" "metamorphic" "metamorphic" ...
 $ rockFold             : chr  NA NA NA NA ...
 $ fullID               : chr  "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" ...

We can see the data set is a lot smaller after removal of rows with ambiguous names.

Extracting information from WoRMS

The World Register of Marine Species (WoRMS) is an authoritative classification and catalogue of marine names. It can provide a range of information. We will be extracting information on taxonomy and functional trait information using the taxize and worrms functions.

You can find all the available attributes on WoRMS here.

Defining functions

First, we’ve got to set-up some functions.

The first function called get_wormsid_noerror extracts unique identifiers for all taxon used in WoRMS called AphiaIDs.

get_wormsid_noerror <- function(sp_name){
  wm_id <- try(taxize::get_wormsid(sp_name,
                                   accepted = TRUE, 
                                   searchtype= "scientific", 
                                   marine_only = FALSE,
                                   ask = FALSE,
                                   row = 1,
                                   message = FALSE),
               silent = TRUE)
  
  #remove end word to attempt matching genus when previous no match
  
  if(class(wm_id) == "try-error"){
    sp_name <- str_remove(sp_name, "(\\s+\\w+)") 
    wm_id <- try(taxize::get_wormsid(sp_name,
                                     accepted = TRUE, 
                                     searchtype= "scientific", 
                                     marine_only = FALSE,
                                     ask = FALSE,
                                     row = 1,
                                     message = FALSE),
                 silent = TRUE)
  } 
  
  #convert non-matched species to NA AphiaID
  
  if(class(wm_id) == "try-error"){
    wm_id <- NA
  } 
  tibble(sciname = sp_name, aphiaID = as.double(unlist(wm_id)))
}

The second function called get_wormsmeta accesses and formats any taxonomic meta data based on Aphia IDs.

get_wormsmeta <- function(aphia_input){
  
  #split into smaller chunks for wm_record() to work
  taxadf_split <- split(aphia_input, (seq(nrow(aphia_input))-1) %/% 50) #split into smaller groups for worms to work
  temp_df <- data.frame()
  
  #run wm_record() through split list
  for (i in taxadf_split) {
    taxa_temp <- wm_record(id = i$aphiaID)
    temp_df = rbind(temp_df, taxa_temp)
  }
  tibble(temp_df)
}

The third function called get_worms_fgrp (originally developed here) accesses and formats information on broad taxonomic groupings of taxa based on Aphia IDs.

get_worms_fgrp <- function(AphiaID) {
  
  #' First, test if the species has attribute data
  attr_dat <- try(wm_attr_data(
    AphiaID, include_inherited = TRUE), silent = TRUE)
  
  #' set up out as null for later use
  out <- NULL
  
  if(!identical(class(attr_dat), "try-error")){
    
    #' if attribute data exists, test if functional group is there
    if("Functional group" %in% attr_dat$measurementType){
      fg_dat <- attr_dat %>% filter(measurementType == "Functional group")
      
      #' Insert if statement here about $children empty
      #' assign the $children - so that it can be used 
      children <- fg_dat$children
      
      if(max(lengths(children)) > 0 ){
        #' Extract the life stage information from the $children field
        life_stage <- children %>% bind_rows() %>%
          dplyr::select(measurementValue) %>%
          dplyr::rename(stage = measurementValue)
        
        #' add in rows for instances missing children
        idx <- which(lengths(children) == 0)
        if(length(idx) > 0){
          life_stage_null <- tibble(stage = rep(as.character(NA), length(children)))
          idy <- (1:length(children))[-idx]
          life_stage_null[idy,] <- life_stage
          life_stage <- life_stage_null
        }
        life_stage <- life_stage %>% bind_cols(., fg_dat)
        
        #' deal with cases where multiple records are returned for the same life stage:
        #' add a suffix to subsequent identical stages (adult_2, etc.)        
        life_stage <- life_stage %>% group_by(stage) %>% dplyr::mutate(nth_stage_val = 1:n()) %>% 
          ungroup() %>% 
          mutate(stage = case_when(
            nth_stage_val == 1 ~ stage,
            TRUE ~ paste(stage, nth_stage_val, sep = "_")
          )
          ) %>% 
          select(-nth_stage_val)
        
        #' create the output to return
        out <- tibble(AphiaID = as.numeric(life_stage$AphiaID),
                      stage = life_stage$stage, fun_grp = life_stage$measurementValue)
        
      } else{
        #' If no life stage info, assume stage is adult
        out <- tibble(AphiaID = as.numeric(fg_dat$AphiaID),
                      stage = "adult", fun_grp = fg_dat$measurementValue)
        
        #' Deal with cases where multiple records are returned (i.e. 2 or more adult fun_grps)
        if(nrow(out) > 1){
          out <- out %>% group_by(stage) %>% dplyr::mutate(nth_stage_val = 1:n()) %>% 
            ungroup() %>% 
            mutate(stage = case_when(
              nth_stage_val == 1 ~ stage,
              TRUE ~ paste(stage, nth_stage_val, sep = "_")
            )
            ) %>% 
            select(-nth_stage_val)
        }
      } 
    }
    
    #' add Pisces, from paraphyletic group: this takes priority over the above
    #' (e.g. class something as Pisces if it is a fish even if it is also listed as benthos)
    if ("Paraphyletic group" %in% attr_dat$measurementType) {
      if(first(
        attr_dat$measurementValue[attr_dat$measurementType == "Paraphyletic group"] == "Pisces")){
        out <- tibble(AphiaID = AphiaID, stage = "adult",
                      fun_grp = first(attr_dat$measurementValue[
                        attr_dat$measurementType == "Paraphyletic group"]))
      }
    }
  }
  #' add other paraphyletic groups: Algae, Algae > Macroalgae, Mangroves this DOES NOT takes priority over the above; i.e. only use if a functional group (e.g. phytoplankton) is not available
  if(is.null(out)){
    if (!identical(class(attr_dat), "try-error") && "Paraphyletic group" %in% attr_dat$measurementType) {
      out <- tibble(AphiaID = AphiaID, stage = "adult",
                    fun_grp = first(attr_dat$measurementValue[
                      attr_dat$measurementType == "Paraphyletic group"]))
    }
  }
  
  #' check taxonomy for other groups
  if(is.null(out)){
    taxo_dat <- try(wm_classification(AphiaID), silent = TRUE)
    if(identical(class(taxo_dat), "try-error")){
      fg <- as.character(NA)
    } else {
      fg <- case_when(
        "Aves" %in% taxo_dat$scientificname ~ "birds",
        "Mammalia" %in% taxo_dat$scientificname ~ "mammals",
        "Reptilia" %in% taxo_dat$scientificname ~ "reptiles",
        TRUE ~ as.character(NA)
      )
    }
    out <- tibble(AphiaID = AphiaID, stage = "adult", fun_grp = fg)
  }
  
  #' what if there are duplicate rows?
  out <- out[!duplicated(out), ]
  out <- out[!(is.na(out$stage)),] #gets rid of NA stages
  
  #' Replace 'not applicable' with NA
  out <- out %>% mutate_all(~ifelse(. == 'not applicable', NA, .))
  
  #' Keep only the life stage with the highest number (if applicable)
  out <- out %>%
    separate(stage, into = c("stage", "number"), sep = "_", remove = FALSE) %>%
    group_by(AphiaID, stage) %>%
    arrange(desc(number)) %>%
    slice(1) %>%
    ungroup() %>%
    select(-number)
  
  #' Convert specific life stages to 'larva_other'
  out <- out %>% mutate(stage = case_when(
    stage %in% c('cerinula', 'larva > planula', 'medusa', 'zoea', 'nauplius', 'polyp', 'medusoid', 'ephyra', 'colony') ~ 'larva_other',
    TRUE ~ stage
  ))
  
  #' do some tidying of the output: tidy up functional_group text
  #' and spread to give one column per life stage
  out <- out %>% 
    distinct(AphiaID, stage, .keep_all = TRUE) %>%  # Add this line to remove duplicates
    mutate(functional_group = case_when(
      str_detect(fun_grp, ">") ~ tolower(word(fun_grp, -1)),
      fun_grp == "Pisces" ~ "fish",
      fun_grp == "Algae > Macroalgae" ~ "macroalgae",
      TRUE ~ tolower(fun_grp)
    )) %>%
    dplyr::select(-fun_grp) %>%
    spread(stage, functional_group)
  
  #' Change column name NA to other
  colnames(out)[colnames(out) == "NA"] <- "other"
  
  #' output the fg data
  out
}

Before we run anything, we need to extract the taxa names we want to run through the functions.

eDNA_taxa_unique_list <- unique(eDNA_long_data_cleaned$taxonomy_clean) #Get unique taxa for WoRMs input as list
eDNA_taxa_unique_df <- data.frame(taxonomy = tolower(unique(eDNA_long_data_cleaned$taxonomy_clean)), 
                                  stringsAsFactors = FALSE) ##Get unique taxa for WoRMs input as df

head(eDNA_taxa_unique_df)
                taxonomy
1              amoebozoa
2               discosea
3            flabellinia
4           neoparamoeba
5               vannella
6 protostelium nocturnum

Get Aphia IDs

Let’s use the function get_wormsid() to obtain Aphia IDs for our taxa.

The duration of this task is approximately 15-minutes for this data set, but can vary depending on the size of the data. Any non-matched species will produce a NA.

To prevent the document taking hours to render, we’ve put # in front of the code for now. We’ve saved the output and reloaded the data back in.

#aphiaID_worms_output <- eDNA_taxa_unique_list %>%
  #purrr::map(get_wormsid_noerror, .progress = TRUE) %>%
  #enframe() %>%
  #unnest(cols = everything()) %>%
  #select(-name)

We’ll save this output to reduce time when rerunning.

#write.csv(aphiaID_worms_output, "Processed_Data/aphiaID_worms_output.csv")

Let’s reload the data back in and do some formatting.

aphiaID_worms_output <- read.csv("Processed_Data/aphiaID_worms_output.csv", row.names = 1)

aphiaID_worms_output$taxonomy_clean = eDNA_taxa_unique_df$taxonomy #add previous taxonomy name for joining later (order remains the same)
aphiaID_worms_output$aphiaID = as.integer(aphiaID_worms_output$aphiaID) #convert to integer for joining

head(aphiaID_worms_output)
                 sciname aphiaID         taxonomy_clean
1              amoebozoa  391848              amoebozoa
2               discosea  582189               discosea
3            flabellinia  582205            flabellinia
4           neoparamoeba  120567           neoparamoeba
5               vannella  120566               vannella
6 protostelium nocturnum      NA protostelium nocturnum

Let’s check how many matches we made.

[1] "You matched 1781 / 2199 taxa with AphiaIDs. Therefore, 418 entries could not be matched and do not have AphiaIDs."

Now let’s add the Aphia IDs to our main data set.

eDNA_long_data_final <- full_join(eDNA_long_data_cleaned, aphiaID_worms_output, by = join_by(taxonomy_clean))

str(eDNA_long_data_final)
'data.frame':   841939 obs. of  73 variables:
 $ taxonomy             : chr  "Amoebozoa" "Amoebozoa" "Amoebozoa" "Amoebozoa" ...
 $ taxonomy_clean       : chr  "amoebozoa" "amoebozoa" "amoebozoa" "amoebozoa" ...
 $ ASV                  : chr  "ASV_3057" "ASV_3512" "ASV_3942" "ASV_4258" ...
 $ Seqs                 : chr  "TTAACGAACGAGACCTTAACCTATTAAATAGTTGCGCGAACTTGAATCATGCGTCATGTTATCTTCGGATAATGTTTCCTCCATGGTTCTATCGTTCTGTGAAAACTTCTT"| __truncated__ "ATAACGAACGAGACCTCAGCCTGCTAACTAGTATGCCTTAGCCTTGTTTTCTTGGCTAAGGAATTTATTGAATATACTTCTTAGAGGGACTATCCGTGTCTAGCGGGTGGAAGTTTGAG" "TTAACGAACGAGACCTTAACCTATTAAATAGTTGCGCGAACTTGAATCATGCGTCAGTTCGTCTTTTGGGCGGACTGTCCTCCATGGTTCTATCGTTCTGTGAAAACTTCT"| __truncated__ "TTAACGAACGAGACCTTAACCTATTAAATAGTTGCGCGAACTTGAATCATGCGTCAGTTCGTCCTTCGTGGGCGAGCTGTCCTCCATGGTTCTATCGTTCTGTGAAAACTT"| __truncated__ ...
 $ reads                : int  0 0 0 0 0 0 0 0 0 0 ...
 $ region               : Factor w/ 6 levels "Scotland","South Wales",..: 1 1 1 1 1 1 1 1 1 1 ...
 $ fieldID              : chr  "PHD1-SCH01-01" "PHD1-SCH01-01" "PHD1-SCH01-01" "PHD1-SCH01-01" ...
 $ primer               : chr  "18S" "18S" "18S" "18S" ...
 $ eventID              : chr  "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" ...
 $ projectID            : chr  "PHD1" "PHD1" "PHD1" "PHD1" ...
 $ localityID           : chr  "SCH01" "SCH01" "SCH01" "SCH01" ...
 $ sampleID             : chr  "1" "1" "1" "1" ...
 $ sampleType           : chr  "sample" "sample" "sample" "sample" ...
 $ controlCheck         : chr  "sample" "sample" "sample" "sample" ...
 $ negCheckLogical      : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
 $ pairedRepLogical     : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
 $ batch_extraction     : int  1 1 1 1 1 1 1 1 1 1 ...
 $ batch_PCR_CO1        : int  2 2 2 2 2 2 2 2 2 2 ...
 $ plate_col_CO1        : int  1 1 1 1 1 1 1 1 1 1 ...
 $ plate_row_CO1        : chr  "A" "A" "A" "A" ...
 $ batch_PCR_18S        : int  4 4 4 4 4 4 4 4 4 4 ...
 $ plate_col_18S        : int  1 1 1 1 1 1 1 1 1 1 ...
 $ plate_row_18S        : chr  "A" "A" "A" "A" ...
 $ date_extraction      : chr  "24.02.2023" "24.02.2023" "24.02.2023" "24.02.2023" ...
 $ date_amplified_CO1   : chr  "28.03.2023" "28.03.2023" "28.03.2023" "28.03.2023" ...
 $ date_amplified_18S   : chr  "27.03.2023" "27.03.2023" "27.03.2023" "27.03.2023" ...
 $ sample_18S           : chr  "S66" "S66" "S66" "S66" ...
 $ sample_CO1           : chr  "Adapter385.SCH01.01" "Adapter385.SCH01.01" "Adapter385.SCH01.01" "Adapter385.SCH01.01" ...
 $ COUNT                : int  2 2 2 2 2 2 2 2 2 2 ...
 $ dna_concentration_CO1: num  82.5 82.5 82.5 82.5 82.5 ...
 $ dna_concentration_18S: num  55.4 55.4 55.4 55.4 55.4 ...
 $ continent            : chr  "Europe" "Europe" "Europe" "Europe" ...
 $ country              : chr  "Scotland" "Scotland" "Scotland" "Scotland" ...
 $ county               : chr  "Sutherland" "Sutherland" "Sutherland" "Sutherland" ...
 $ waterBody            : chr  "rocky" "rocky" "rocky" "rocky" ...
 $ verbatimLocality     : chr  "Scourie" "Scourie" "Scourie" "Scourie" ...
 $ exposure             : chr  "Exposed" "Exposed" "Exposed" "Exposed" ...
 $ weather              : chr  "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" ...
 $ tide                 : chr  "outgoing" "outgoing" "outgoing" "outgoing" ...
 $ lowWater             : chr  "12:23" "12:23" "12:23" "12:23" ...
 $ decimalLongitude     : num  -5.17 -5.17 -5.17 -5.17 -5.17 ...
 $ decimalLatitude      : num  58.4 58.4 58.4 58.4 58.4 ...
 $ recordedBy           : chr  "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" ...
 $ year                 : int  2022 2022 2022 2022 2022 2022 2022 2022 2022 2022 ...
 $ month                : int  6 6 6 6 6 6 6 6 6 6 ...
 $ day                  : int  12 12 12 12 12 12 12 12 12 12 ...
 $ eventTime            : chr  "09:31" "09:31" "09:31" "09:31" ...
 $ samplingProtocol     : chr  "Sterivex-0.22" "Sterivex-0.22" "Sterivex-0.22" "Sterivex-0.22" ...
 $ pumpType             : chr  "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" ...
 $ repVol..mL.          : int  1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 ...
 $ algaeCover.          : int  0 0 0 0 0 0 0 0 0 0 ...
 $ remarks              : chr  "Filtered on shore" "Filtered on shore" "Filtered on shore" "Filtered on shore" ...
 $ daysBeforefreeze     : int  9 9 9 9 9 9 9 9 9 9 ...
 $ preservation         : chr  "EtOH" "EtOH" "EtOH" "EtOH" ...
 $ type                 : chr  "Rockpool" "Rockpool" "Rockpool" "Rockpool" ...
 $ shorePosition        : chr  "High" "High" "High" "High" ...
 $ rockpoolarea.cm.2.   : num  7443 7443 7443 7443 7443 ...
 $ depth1               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ depth2               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averageDepth..cm.    : num  25 25 25 25 25 25 25 25 25 25 ...
 $ rockpoolVol.m.3.     : num  0.186 0.186 0.186 0.186 0.186 ...
 $ pH1                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ pH2                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averagePH            : num  8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 ...
 $ temp1                : chr  NA NA NA NA ...
 $ temp2                : chr  NA NA NA NA ...
 $ averageTemp          : num  13 13 13 13 13 13 13 13 13 13 ...
 $ siteImage            : chr  "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" ...
 $ rockType             : chr  "metamorphic" "metamorphic" "metamorphic" "metamorphic" ...
 $ rockFold             : chr  NA NA NA NA ...
 $ fullID               : chr  "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" ...
 $ sciname              : chr  "amoebozoa" "amoebozoa" "amoebozoa" "amoebozoa" ...
 $ aphiaID              : int  391848 391848 391848 391848 391848 391848 391848 391848 391848 391848 ...

Get taxonomic metadata

Next, let’s use the function get_wormsmeta() to obtain taxonomic information for our Aphia IDs. This command takes a few minutes to run.

worms_meta_output <- get_wormsmeta(aphiaID_worms_output)

Let’s look at the output. We can see we now have lots of information for each taxon.

str(worms_meta_output)
tibble [2,199 × 27] (S3: tbl_df/tbl/data.frame)
 $ AphiaID          : int [1:2199] 391848 582189 582205 120567 120566 NA NA 1317 NA NA ...
 $ url              : chr [1:2199] "https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848" "https://www.marinespecies.org/aphia.php?p=taxdetails&id=582189" "https://www.marinespecies.org/aphia.php?p=taxdetails&id=582205" "https://www.marinespecies.org/aphia.php?p=taxdetails&id=120567" ...
 $ scientificname   : chr [1:2199] "Amoebozoa" "Discosea" "Flabellinia" "Neoparamoeba" ...
 $ authority        : chr [1:2199] "Lühe, 1913, emend. Cavalier-Smith, 1998" "Cavalier-Smith et al., 2004" "Smirnov et al., 2005" "F.C.Page, 1987" ...
 $ status           : chr [1:2199] "accepted" "accepted" "accepted" "accepted" ...
 $ unacceptreason   : logi [1:2199] NA NA NA NA NA NA ...
 $ taxonRankID      : int [1:2199] 30 60 70 180 180 NA NA 100 NA NA ...
 $ rank             : chr [1:2199] "Phylum" "Class" "Subclass" "Genus" ...
 $ valid_AphiaID    : int [1:2199] 391848 582189 582205 120567 120566 NA NA 1317 NA NA ...
 $ valid_name       : chr [1:2199] "Amoebozoa" "Discosea" "Flabellinia" "Neoparamoeba" ...
 $ valid_authority  : chr [1:2199] "Lühe, 1913, emend. Cavalier-Smith, 1998" "Cavalier-Smith et al., 2004" "Smirnov et al., 2005" "F.C.Page, 1987" ...
 $ parentNameUsageID: int [1:2199] 582160 582168 582189 22725 22724 NA NA 582188 NA NA ...
 $ kingdom          : chr [1:2199] "Protozoa" "Protozoa" "Protozoa" "Protozoa" ...
 $ phylum           : chr [1:2199] "Amoebozoa" "Amoebozoa" "Amoebozoa" "Amoebozoa" ...
 $ class            : chr [1:2199] NA "Discosea" "Discosea" "Discosea" ...
 $ order            : chr [1:2199] NA NA NA "Dactylopodida" ...
 $ family           : chr [1:2199] NA NA NA "Vexilliferidae" ...
 $ genus            : chr [1:2199] NA NA NA "Neoparamoeba" ...
 $ citation         : chr [1:2199] "WoRMS (2025). Amoebozoa. Accessed at: https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848 on 2025-03-20" "Guiry, M.D. & Guiry, G.M. (2025). AlgaeBase. World-wide electronic publication, National University of Ireland,"| __truncated__ "Guiry, M.D. & Guiry, G.M. (2025). AlgaeBase. World-wide electronic publication, National University of Ireland,"| __truncated__ "Guiry, M.D. & Guiry, G.M. (2025). AlgaeBase. World-wide electronic publication, National University of Ireland,"| __truncated__ ...
 $ lsid             : chr [1:2199] "urn:lsid:marinespecies.org:taxname:391848" "urn:lsid:marinespecies.org:taxname:582189" "urn:lsid:marinespecies.org:taxname:582205" "urn:lsid:marinespecies.org:taxname:120567" ...
 $ isMarine         : int [1:2199] 1 1 1 1 1 NA NA 1 NA NA ...
 $ isBrackish       : int [1:2199] 1 1 NA NA NA NA NA 1 NA NA ...
 $ isFreshwater     : int [1:2199] 1 1 1 NA 1 NA NA 1 NA NA ...
 $ isTerrestrial    : int [1:2199] 1 1 NA NA NA NA NA 1 NA NA ...
 $ isExtinct        : int [1:2199] NA NA NA NA NA NA NA NA NA NA ...
 $ match_type       : chr [1:2199] "exact" "exact" "exact" "exact" ...
 $ modified         : chr [1:2199] "2011-10-14T10:07:31.253Z" "2011-10-14T10:07:31.253Z" "2011-10-14T10:07:31.253Z" "2024-02-21T07:10:53.720Z" ...

A bit of tidying of this output is required to be able to join it with our own.

worms_meta_output_tidy <- worms_meta_output %>%
  dplyr::rename(aphiaID = AphiaID) %>%
  filter(!is.na(aphiaID)) %>% #remove NAs
  distinct() #remove duplicates

Now let’s add the taxonomic metadata to our main data set and check the joining of data sets worked.

eDNA_long_data_final <- right_join(eDNA_long_data_final, worms_meta_output_tidy, by = "aphiaID") #worms meta

which(is.na(eDNA_long_data_final$aphiaID), arr.ind=TRUE) #check NAs in IDs
integer(0)
any(duplicated(eDNA_long_data_final)) #check for duplicates
[1] FALSE

Get broad functional groups

Finally, let’s use the function get_worms_fgrp() to obtain the broad taxonomic groups of our taxa.

Similar to above, this command takes a long time (approximately 30 minutes with this data set). We have put # in front of this code to reduce time to render.

species <- tibble(AphiaID = c(unique(eDNA_long_data_final$aphiaID))) #list aphiaIDs

#worms_fgrp_output <- species %>%
  #group_by(AphiaID) %>%
  #do(get_worms_fgrp(AphiaID = .$AphiaID))

We’ll save this output to reduce time when rerunning.

#write.csv(worms_fgrp_output, "Processed_Data/worms_fgrp_output.csv")

Let’s reload the data back in.

worms_fgrp_output <- read.csv("Processed_Data/worms_fgrp_output.csv", row.names = 1)

Let’s see how many matches we got.

[1] "You found function groups for 1435 / 1780 adult taxa. Therefore, 345 have no functional group."

Now let’s add the functional group information to our main data set and check the joining of data sets worked.

worms_fgrp_output_tidy<- worms_fgrp_output %>% dplyr::rename(aphiaID = AphiaID)
eDNA_long_data_final <- left_join(eDNA_long_data_final, worms_fgrp_output_tidy)

Quick look at the final long data set (remember this has not been decontaminated yet!).

str(eDNA_long_data_final)
'data.frame':   715430 obs. of  104 variables:
 $ taxonomy             : chr  "Amoebozoa" "Amoebozoa" "Amoebozoa" "Amoebozoa" ...
 $ taxonomy_clean       : chr  "amoebozoa" "amoebozoa" "amoebozoa" "amoebozoa" ...
 $ ASV                  : chr  "ASV_3057" "ASV_3512" "ASV_3942" "ASV_4258" ...
 $ Seqs                 : chr  "TTAACGAACGAGACCTTAACCTATTAAATAGTTGCGCGAACTTGAATCATGCGTCATGTTATCTTCGGATAATGTTTCCTCCATGGTTCTATCGTTCTGTGAAAACTTCTT"| __truncated__ "ATAACGAACGAGACCTCAGCCTGCTAACTAGTATGCCTTAGCCTTGTTTTCTTGGCTAAGGAATTTATTGAATATACTTCTTAGAGGGACTATCCGTGTCTAGCGGGTGGAAGTTTGAG" "TTAACGAACGAGACCTTAACCTATTAAATAGTTGCGCGAACTTGAATCATGCGTCAGTTCGTCTTTTGGGCGGACTGTCCTCCATGGTTCTATCGTTCTGTGAAAACTTCT"| __truncated__ "TTAACGAACGAGACCTTAACCTATTAAATAGTTGCGCGAACTTGAATCATGCGTCAGTTCGTCCTTCGTGGGCGAGCTGTCCTCCATGGTTCTATCGTTCTGTGAAAACTT"| __truncated__ ...
 $ reads                : int  0 0 0 0 0 0 0 0 0 0 ...
 $ region               : Factor w/ 6 levels "Scotland","South Wales",..: 1 1 1 1 1 1 1 1 1 1 ...
 $ fieldID              : chr  "PHD1-SCH01-01" "PHD1-SCH01-01" "PHD1-SCH01-01" "PHD1-SCH01-01" ...
 $ primer               : chr  "18S" "18S" "18S" "18S" ...
 $ eventID              : chr  "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" "PHD1-2022.06.12-SCH01-01" ...
 $ projectID            : chr  "PHD1" "PHD1" "PHD1" "PHD1" ...
 $ localityID           : chr  "SCH01" "SCH01" "SCH01" "SCH01" ...
 $ sampleID             : chr  "1" "1" "1" "1" ...
 $ sampleType           : chr  "sample" "sample" "sample" "sample" ...
 $ controlCheck         : chr  "sample" "sample" "sample" "sample" ...
 $ negCheckLogical      : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
 $ pairedRepLogical     : logi  FALSE FALSE FALSE FALSE FALSE FALSE ...
 $ batch_extraction     : int  1 1 1 1 1 1 1 1 1 1 ...
 $ batch_PCR_CO1        : int  2 2 2 2 2 2 2 2 2 2 ...
 $ plate_col_CO1        : int  1 1 1 1 1 1 1 1 1 1 ...
 $ plate_row_CO1        : chr  "A" "A" "A" "A" ...
 $ batch_PCR_18S        : int  4 4 4 4 4 4 4 4 4 4 ...
 $ plate_col_18S        : int  1 1 1 1 1 1 1 1 1 1 ...
 $ plate_row_18S        : chr  "A" "A" "A" "A" ...
 $ date_extraction      : chr  "24.02.2023" "24.02.2023" "24.02.2023" "24.02.2023" ...
 $ date_amplified_CO1   : chr  "28.03.2023" "28.03.2023" "28.03.2023" "28.03.2023" ...
 $ date_amplified_18S   : chr  "27.03.2023" "27.03.2023" "27.03.2023" "27.03.2023" ...
 $ sample_18S           : chr  "S66" "S66" "S66" "S66" ...
 $ sample_CO1           : chr  "Adapter385.SCH01.01" "Adapter385.SCH01.01" "Adapter385.SCH01.01" "Adapter385.SCH01.01" ...
 $ COUNT                : int  2 2 2 2 2 2 2 2 2 2 ...
 $ dna_concentration_CO1: num  82.5 82.5 82.5 82.5 82.5 ...
 $ dna_concentration_18S: num  55.4 55.4 55.4 55.4 55.4 ...
 $ continent            : chr  "Europe" "Europe" "Europe" "Europe" ...
 $ country              : chr  "Scotland" "Scotland" "Scotland" "Scotland" ...
 $ county               : chr  "Sutherland" "Sutherland" "Sutherland" "Sutherland" ...
 $ waterBody            : chr  "rocky" "rocky" "rocky" "rocky" ...
 $ verbatimLocality     : chr  "Scourie" "Scourie" "Scourie" "Scourie" ...
 $ exposure             : chr  "Exposed" "Exposed" "Exposed" "Exposed" ...
 $ weather              : chr  "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" "moderate rain, strong winds, very cloudy" ...
 $ tide                 : chr  "outgoing" "outgoing" "outgoing" "outgoing" ...
 $ lowWater             : chr  "12:23" "12:23" "12:23" "12:23" ...
 $ decimalLongitude     : num  -5.17 -5.17 -5.17 -5.17 -5.17 ...
 $ decimalLatitude      : num  58.4 58.4 58.4 58.4 58.4 ...
 $ recordedBy           : chr  "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" "Dina-Leigh Simons; Nova Mieszkowska" ...
 $ year                 : int  2022 2022 2022 2022 2022 2022 2022 2022 2022 2022 ...
 $ month                : int  6 6 6 6 6 6 6 6 6 6 ...
 $ day                  : int  12 12 12 12 12 12 12 12 12 12 ...
 $ eventTime            : chr  "09:31" "09:31" "09:31" "09:31" ...
 $ samplingProtocol     : chr  "Sterivex-0.22" "Sterivex-0.22" "Sterivex-0.22" "Sterivex-0.22" ...
 $ pumpType             : chr  "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" "Syringe 60mL, sealant gun" ...
 $ repVol..mL.          : int  1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 ...
 $ algaeCover.          : int  0 0 0 0 0 0 0 0 0 0 ...
 $ remarks              : chr  "Filtered on shore" "Filtered on shore" "Filtered on shore" "Filtered on shore" ...
 $ daysBeforefreeze     : int  9 9 9 9 9 9 9 9 9 9 ...
 $ preservation         : chr  "EtOH" "EtOH" "EtOH" "EtOH" ...
 $ type                 : chr  "Rockpool" "Rockpool" "Rockpool" "Rockpool" ...
 $ shorePosition        : chr  "High" "High" "High" "High" ...
 $ rockpoolarea.cm.2.   : num  7443 7443 7443 7443 7443 ...
 $ depth1               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ depth2               : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averageDepth..cm.    : num  25 25 25 25 25 25 25 25 25 25 ...
 $ rockpoolVol.m.3.     : num  0.186 0.186 0.186 0.186 0.186 ...
 $ pH1                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ pH2                  : num  NA NA NA NA NA NA NA NA NA NA ...
 $ averagePH            : num  8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 8.59 ...
 $ temp1                : chr  NA NA NA NA ...
 $ temp2                : chr  NA NA NA NA ...
 $ averageTemp          : num  13 13 13 13 13 13 13 13 13 13 ...
 $ siteImage            : chr  "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" "IMG_SCH01-01.jpeg" ...
 $ rockType             : chr  "metamorphic" "metamorphic" "metamorphic" "metamorphic" ...
 $ rockFold             : chr  NA NA NA NA ...
 $ fullID               : chr  "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" "PHD1-SCH01-01_18S" ...
 $ sciname              : chr  "amoebozoa" "amoebozoa" "amoebozoa" "amoebozoa" ...
 $ aphiaID              : int  391848 391848 391848 391848 391848 391848 391848 391848 391848 391848 ...
 $ url                  : chr  "https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848" "https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848" "https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848" "https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848" ...
 $ scientificname       : chr  "Amoebozoa" "Amoebozoa" "Amoebozoa" "Amoebozoa" ...
 $ authority            : chr  "Lühe, 1913, emend. Cavalier-Smith, 1998" "Lühe, 1913, emend. Cavalier-Smith, 1998" "Lühe, 1913, emend. Cavalier-Smith, 1998" "Lühe, 1913, emend. Cavalier-Smith, 1998" ...
 $ status               : chr  "accepted" "accepted" "accepted" "accepted" ...
 $ unacceptreason       : logi  NA NA NA NA NA NA ...
 $ taxonRankID          : int  30 30 30 30 30 30 30 30 30 30 ...
 $ rank                 : chr  "Phylum" "Phylum" "Phylum" "Phylum" ...
 $ valid_AphiaID        : int  391848 391848 391848 391848 391848 391848 391848 391848 391848 391848 ...
 $ valid_name           : chr  "Amoebozoa" "Amoebozoa" "Amoebozoa" "Amoebozoa" ...
 $ valid_authority      : chr  "Lühe, 1913, emend. Cavalier-Smith, 1998" "Lühe, 1913, emend. Cavalier-Smith, 1998" "Lühe, 1913, emend. Cavalier-Smith, 1998" "Lühe, 1913, emend. Cavalier-Smith, 1998" ...
 $ parentNameUsageID    : int  582160 582160 582160 582160 582160 582160 582160 582160 582160 582160 ...
 $ kingdom              : chr  "Protozoa" "Protozoa" "Protozoa" "Protozoa" ...
 $ phylum               : chr  "Amoebozoa" "Amoebozoa" "Amoebozoa" "Amoebozoa" ...
 $ class                : chr  NA NA NA NA ...
 $ order                : chr  NA NA NA NA ...
 $ family               : chr  NA NA NA NA ...
 $ genus                : chr  NA NA NA NA ...
 $ citation             : chr  "WoRMS (2025). Amoebozoa. Accessed at: https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848 on 2025-03-20" "WoRMS (2025). Amoebozoa. Accessed at: https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848 on 2025-03-20" "WoRMS (2025). Amoebozoa. Accessed at: https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848 on 2025-03-20" "WoRMS (2025). Amoebozoa. Accessed at: https://www.marinespecies.org/aphia.php?p=taxdetails&id=391848 on 2025-03-20" ...
 $ lsid                 : chr  "urn:lsid:marinespecies.org:taxname:391848" "urn:lsid:marinespecies.org:taxname:391848" "urn:lsid:marinespecies.org:taxname:391848" "urn:lsid:marinespecies.org:taxname:391848" ...
 $ isMarine             : int  1 1 1 1 1 1 1 1 1 1 ...
 $ isBrackish           : int  1 1 1 1 1 1 1 1 1 1 ...
 $ isFreshwater         : int  1 1 1 1 1 1 1 1 1 1 ...
 $ isTerrestrial        : int  1 1 1 1 1 1 1 1 1 1 ...
 $ isExtinct            : int  NA NA NA NA NA NA NA NA NA NA ...
 $ match_type           : chr  "exact" "exact" "exact" "exact" ...
 $ modified             : chr  "2011-10-14T10:07:31.253Z" "2011-10-14T10:07:31.253Z" "2011-10-14T10:07:31.253Z" "2011-10-14T10:07:31.253Z" ...
  [list output truncated]

Tidy functional groups

We get a wide range of different groups from WoRMS. For analysis later on, we need to tidy these names.

#| label: tidy-functional-groups

# Tidy functional groups
eDNA_long_data_final$adult_tidy <- dplyr::recode(
  eDNA_long_data_final$adult,
  "zooplankton" = "Plankton",
  "microbenthos" = "Microbenthos",
  "benthos" = "Macrobenthos",
  "phytoplankton" = "Plankton",
  "algae" = "Plankton",
  "macrobenthos" = "Macrobenthos",
  "macroalgae" = "Macroalgae",
  "fish" = "Fish",
  "meiobenthos" = "Macrobenthos",
  "mixoplankton" = "Plankton",
  "nekton" = "Nekton",
  "macroplankton" = 'Plankton',
  "nanoplankton" = 'Plankton',
  "epibenthos" = 'Epibenthos',
  "endobenthos" = 'Endobenthos',
  "microplankton" = 'Plankton',
  "megabenthos" = 'Macrobenthos',
  "mesoplankton" = 'Plankton',
  "macro" = "Edaphofauna", #in the 'soil'
  "plankton" = "Plankton",
  "phytobenthos" = "Seagrass",
  "turbellaria" = 'Macrobenthos'
)

# Simplify functional groups
eDNA_long_data_final$adult_simple <- dplyr::recode(
  eDNA_long_data_final$adult,
  "zooplankton" = "Other",
  "benthos" = "Macrobenthos",
  "microbenthos" = "Other",
  "phytoplankton" = "Other",
  "algae" = "Other",
  "macrobenthos" = "Macrobenthos",
  "macroalgae" = "Macroalgae",
  "meiobenthos" = "Macrobenthos",
  "mixoplankton" = "Other",
  "nekton" = "Other",
  "macroplankton" = 'Other',
  "nanoplankton" = 'Other',
  "epibenthos" = 'Macrobenthos',
  "endobenthos" = 'Macrobenthos',
  "microplankton" = 'Other',
  "megabenthos" = 'Macrobenthos',
  "mesoplankton" = 'Other',
  "macro" = "Macrobenthos", #in the 'soil'
  "plankton" = "Other",
  "phytobenthos" = "Other",
  "turbellaria" = 'Macrobenthos'
)

Before we convert our data into a phyloseq object and filter our target taxa, let’s explore out functional groups over the different shore heights.

#| label: explore-functional-groups

# add pa variable and remove absences
eDNA_long_data_final_pa <- eDNA_long_data_final %>%
  mutate(pa = ifelse(reads > 0, 1, 0))

eDNA_long_data_final_pa <- eDNA_long_data_final_pa %>% filter(pa > 0)

# Summarize the data to count the number of taxa by shorePosition
df_summary <- eDNA_long_data_final_pa %>% 
  dplyr::group_by(shorePosition, adult_tidy) %>%
  dplyr::summarise(n_taxa = n(), .groups = 'drop')

# Calculate the total number of taxa in each shorePosition
df_summary <- df_summary %>%
  dplyr::group_by(shorePosition) %>%
  dplyr::mutate(total_taxa = sum(n_taxa)) %>%
  ungroup()

# Calculate the proportion of taxa in each zone within each shorePosition
df_summary <- df_summary %>%
  mutate(proportion = n_taxa / total_taxa)

# Plot
ggplot(df_summary, aes(x = shorePosition, y = proportion, fill = adult_tidy)) +
  geom_bar(stat = "identity") +
  geom_text(aes(label = sprintf("%.1f%%", proportion * 100)),  # Format with 1 decimal place and add "%"
            position = position_stack(vjust = 0.5),  # Center text within bars
            size = 3.5,  
            color = "black") +   
  theme_classic()

Create phyloseq object

We’ve now got a tidied long data set with lots of meta data. To aid further check and analyses, we can convert our long data into a phyloseq object to be used in the phyloseq package.

First, we need to document and remove any failed samples.

failed_samples <- c("PHD1-SCH02-03_CO1",
                    "PHD1-SCH02-05_CO1",
                    "PHD1-SCH03-05rep_CO1",
                    "PHD1-SCH04-03_CO1",
                    "PHD1-SCH06-05_18S",
                    "PHD1-SW04-01_CO1",
                    "PHD1-SW06-02_18S",
                    "PHD2-CN02-03_18S",
                    "PHD2-CN05-02_18S",
                    "PHD2-NE01-09_CO1",
                    "PHD2-NE02-03_CO1",
                    "PHD2-NE04-03_18S",
                    "PHD2-NW03-01_CO1")

eDNA_long_data_removefailed <- filter(eDNA_long_data_final, !fullID %in% failed_samples)

Create tax_table()

We need to extract all the taxonomic information from our long data and do some tidying.

taxa <- unique(subset(eDNA_long_data_removefailed, select = c("kingdom", 
                                             "phylum", 
                                             "class", 
                                             "order", 
                                             "family", 
                                             "genus", 
                                             "valid_name",
                                             "scientificname",
                                             "adult", #original fn group,
                                             "adult_simple", # simple fn group
                                             "adult_tidy",# tidy fn group
                                             "valid_AphiaID",
                                             "rank"))) 

taxa$scientificname <- as.factor(taxa$scientificname)
taxa <- taxa[order(taxa$scientificname),] #order alphabetically to match other ps elements
rownames(taxa) <-taxa$scientificname
taxa <- as.matrix(taxa)

Now, save the taxa matrix as a tax_table() object.

phylo_tax <- tax_table(taxa)

Create sample_data()

Similarly, need to extract all the relavent sample information from our long data and do some tidying.

meta <- unique(subset(eDNA_long_data_removefailed, select = c("fieldID",
                                             "projectID",
                                             "eventID",
                                             "type", 
                                             "verbatimLocality",
                                             "localityID",
                                             "shorePosition", 
                                             "fullID",
                                             "year",
                                             "month",
                                             "day",
                                             "eventTime",
                                             "dna_concentration_CO1",
                                             "dna_concentration_18S",
                                             "negCheckLogical",
                                             "pairedRepLogical",
                                             "country",
                                             "controlCheck",
                                             "sampleType",
                                             "primer",
                                             "date_amplified_CO1",
                                             "date_amplified_18S",
                                             "batch_extraction",
                                             "batch_PCR_CO1",
                                             "plate_col_CO1",
                                             "plate_row_CO1",
                                             "batch_PCR_18S",
                                             "plate_col_18S",
                                             "plate_row_18S",
                                             "date_extraction",
                                             "exposure",
                                             "weather",
                                             "tide",
                                             "lowWater",
                                             "decimalLongitude",
                                             "decimalLatitude",
                                             "eventTime",
                                             "rockpoolarea.cm.2.",
                                             "averageDepth..cm.",
                                             "rockpoolVol.m.3.",
                                             "averagePH",
                                             "averageTemp"
)))

meta <- meta[order(meta$fullID),] #order rows alphabetically
rownames(meta) <-meta$fullID

Now, save the sample matrix as a sample_data() object.

phylo_samples <- sample_data(meta)

Create otu_table()

Since our data are currently in long format, we need to recreate the ASV matrix through some data wrangling.

species_reads_long <- eDNA_long_data_removefailed %>%
  select(ASV, reads, fullID) %>%
  mutate(across(c(ASV, fullID), as.factor)) %>%
  distinct()

str(species_reads_long)
'data.frame':   712877 obs. of  3 variables:
 $ ASV   : Factor w/ 6321 levels "ASV_1","ASV_10",..: 3051 3391 3692 3892 4707 4838 4863 5068 5286 5749 ...
 $ reads : int  0 0 0 0 0 0 0 0 0 0 ...
 $ fullID: Factor w/ 655 levels "PHD1-NCbead_CO1",..: 6 6 6 6 6 6 6 6 6 6 ...
which(is.na(species_reads_long)) #check for NAs
integer(0)

Turning our long data into a wide format takes a long time due to the size of the data.

species_reads_wide <- species_reads_long %>% 
  pivot_wider(names_from = fullID, 
              values_from = reads, 
              values_fill = list(reads = 0)) %>% 
  as.data.frame()

A bit of formatting is needed for joining elements together later on. We can see that we have 6321 ASVs and 655 samples.

#order names alphabetically
species_reads_wide<- species_reads_wide[order(species_reads_wide$ASV),] #order rows alphabetically
species_reads_wide <- species_reads_wide[,order(colnames(species_reads_wide))] #order cols alphabetically

#update row names to ASVs
rownames(species_reads_wide) <- NULL
species_reads_wide <- species_reads_wide %>% column_to_rownames(var="ASV")

dim(species_reads_wide)
[1] 6321  655

We can also repeat the last few steps but group by scientificname to get a taxa-level otu_table . In my further analyses, taxa-level detection are appropriate and so we will move forward using this otu_table.

We can see that we have 1780 ASVs and 655 samples.

#| label: format-otu-table-long-taxa

species_reads_long_taxa <- eDNA_long_data_removefailed %>%
  select(ASV, scientificname, reads, fullID) %>%
  mutate(across(c(ASV, scientificname, fullID), as.factor)) %>%
  distinct()

species_reads_long_taxa_grouped <- species_reads_long_taxa %>% 
  group_by(scientificname, fullID) %>% 
  summarize(reads = sum(reads, na.rm = TRUE), .groups = "drop")

species_reads_wide_taxa <- species_reads_long_taxa_grouped %>% 
  pivot_wider(names_from = fullID, 
              values_from = reads, 
              values_fill = list(reads = 0)) %>% 
  as.data.frame()

#order names alphabetically
species_reads_wide_taxa<- species_reads_wide_taxa[order(species_reads_wide_taxa$scientificname),] #order rows alphabetically
species_reads_wide_taxa <- species_reads_wide_taxa[,order(colnames(species_reads_wide_taxa))] #order cols alphabetically

#update row names to ASVs
rownames(species_reads_wide_taxa) <- NULL
species_reads_wide_taxa <- species_reads_wide_taxa %>% column_to_rownames(var="scientificname")

dim(species_reads_wide_taxa)
[1] 1780  655

Now let’s create our otu_table elements - one at a ASV level (in case we need it later on) and one at a taxa-level (which we’ll use for compiling the phyloseq object).

phylo_asv <- otu_table(species_reads_wide, taxa_are_rows=TRUE)
phylo_asv_taxa <- otu_table(species_reads_wide_taxa, taxa_are_rows=TRUE)

It’s useful to do some checks befor we compile our taxa-level phyloseq object to make sure everything aligns correctly. This is why we’ve performed the alphabetical ordering in the above steps.

# Check if colnames in asv object match meta rownames
list1<- colnames(phylo_asv_taxa)
list2 <- rownames(phylo_samples)
which(list1 != list2) #should be NULL
integer(0)
# Check if species names match in asv object and taxa object
list1<- rownames(phylo_asv_taxa)
list2 <- rownames(phylo_tax)
which(list1 != list2) #should be NULL
integer(0)
phylo_eDNA <- phyloseq(phylo_asv_taxa, phylo_tax, phylo_samples)

# Remove taxa wihout occurances from the data
phylo_eDNA <- subset_taxa(phylo_eDNA, taxa_sums(phylo_eDNA) > 0)

Explore phyloseq object

Let’s take a look at what the phyloseq object looks like.

head(sample_names(phylo_eDNA)) #check sample names
[1] "PHD1-NCbead_CO1"   "PHD1-NCrep_18S"    "PHD1-NCrep_CO1"   
[4] "PHD1-PCrep_18S"    "PHD1-PCrep_CO1"    "PHD1-SCH01-01_18S"
head(rank_names(phylo_eDNA)) #check taxonomic information
[1] "kingdom" "phylum"  "class"   "order"   "family"  "genus"  
head(sample_variables(phylo_eDNA)) #check meta data 
[1] "fieldID"          "projectID"        "eventID"          "type"            
[5] "verbatimLocality" "localityID"      
phylo_eDNA
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 1725 taxa and 655 samples ]
sample_data() Sample Data:       [ 655 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 1725 taxa by 13 taxonomic ranks ]
microbiome::summarize_phyloseq(phylo_eDNA) #full summary
[[1]]
[1] "1] Min. number of reads = 0"

[[2]]
[1] "2] Max. number of reads = 352001"

[[3]]
[1] "3] Total number of reads = 25709925"

[[4]]
[1] "4] Average number of reads = 39251.7938931298"

[[5]]
[1] "5] Median number of reads = 24570"

[[6]]
[1] "7] Sparsity = 0.9644128775307"

[[7]]
[1] "6] Any OTU sum to 1 or less? NO"

[[8]]
[1] "8] Number of singletons = 0"

[[9]]
[1] "9] Percent of OTUs that are singletons \n        (i.e. exactly one read detected across all samples)0"

[[10]]
[1] "10] Number of sample variables are: 42"

[[11]]
 [1] "fieldID"               "projectID"             "eventID"              
 [4] "type"                  "verbatimLocality"      "localityID"           
 [7] "shorePosition"         "fullID"                "year"                 
[10] "month"                 "day"                   "eventTime"            
[13] "dna_concentration_CO1" "dna_concentration_18S" "negCheckLogical"      
[16] "pairedRepLogical"      "country"               "controlCheck"         
[19] "sampleType"            "primer"                "date_amplified_CO1"   
[22] "date_amplified_18S"    "batch_extraction"      "batch_PCR_CO1"        
[25] "plate_col_CO1"         "plate_row_CO1"         "batch_PCR_18S"        
[28] "plate_col_18S"         "plate_row_18S"         "date_extraction"      
[31] "exposure"              "weather"               "tide"                 
[34] "lowWater"              "decimalLongitude"      "decimalLatitude"      
[37] "eventTime.1"           "rockpoolarea.cm.2."    "averageDepth..cm."    
[40] "rockpoolVol.m.3."      "averagePH"             "averageTemp"          
table(meta(phylo_eDNA)$controlCheck, useNA = "always") #control type

 control positive   sample     <NA> 
     101       30      524        0 
# save under different name for quality control checks later
phylo_eDNA_predecontam <- phylo_eDNA

Decontamination

Visualizing contaminants

Let’s produce some figures to visualize potential contaminates present in our negative controls.

We need to subset the negative control samples first.

phylo_neg_controls = subset_samples(phylo_eDNA, sampleType == "field-control" | sampleType == "lab-negative-control") 

# Clean out taxa/ASV columns that are no longer present.
phylo_neg_controls <- prune_taxa(taxa_sums(phylo_neg_controls) > 0, phylo_neg_controls)

Let’s check the distribution of taxa in the negative controls.

plot(sort(taxa_sums(phylo_neg_controls), TRUE), type="h")

It might be useful to view contaminates by primer. Let’s look at 18S first.

phylo_neg_18S <- subset_samples(phylo_neg_controls, primer == "18S")

(contam_18S_plot<- plot_bar(phylo_neg_18S, "fullID", fill = "phylum") +
  facet_wrap(.~ primer)+
  theme(legend.position = 'none'))

And now for CO1.

phylo_neg_CO1 <- subset_samples(phylo_neg_controls, primer == "CO1")

(contam_CO1_plot<- plot_bar(phylo_neg_CO1, "fullID", fill = "phylum") +
  facet_wrap(.~ primer) +
  theme(legend.position = 'none'))

We can also find taxa that are shared among a certain number of negative controls. As an example, we check which taxa are present in more than five samples.

controls_shared_taxa = filter_taxa(phylo_neg_controls, 
                                   function(x) sum(x >= 1) == (5), TRUE)
plot_bar(controls_shared_taxa, "fullID", fill = "scientificname")

We can also visualize our original PCR plates (if we have variables in our metadata which state the position of samples on the plates).

First, calculate overall read depth across samples and this to our sample data.

#Calculate read depths
sample_depths <- microbiome::readcount(phylo_eDNA)
sample_depths_df <- as.data.frame(sample_depths)
sample_depths_df <- tibble::rownames_to_column(sample_depths_df, "fullID")
head(sample_depths_df)
             fullID sample_depths
1   PHD1-NCbead_CO1            48
2    PHD1-NCrep_18S          1205
3    PHD1-NCrep_CO1             0
4    PHD1-PCrep_18S             0
5    PHD1-PCrep_CO1             0
6 PHD1-SCH01-01_18S         43943
# add depths to sample data
sample_data <- sample_data(phylo_eDNA)
sample_data[,"depth"] <- sample_depths

Let’s look at CO1 first.

# Filter out NA values
sample_data_CO1 <- sample_data[!is.na(sample_data$plate_row_CO1), ]

# Reorder levels of plate_row_CO1
sample_data_CO1$plate_row_CO1 <- factor(sample_data_CO1$plate_row_CO1, 
                                        levels = rev(LETTERS[1:8]))

# Relabel PCR plates
sample_data_CO1$batch_PCR_CO1 <- recode(sample_data_CO1$batch_PCR_CO1,
                                    "1" = "SW-CO1",
                                    "2" = "SCH-CO1",
                                    "3" = "SW-18S",
                                    "4" = "SCH-18S",
                                    "5" = "NW-18S",
                                    "6" = "NE-18S",
                                    "7" = "CN-18S",
                                    "8" = "NW-CO1",
                                    "9" = "NE-CO1",
                                    "10" = "CN-CO1")

# Plot with facet_wrap and circles representing concentrations - CO1 first
pcr_plate_CO1 <- ggplot(sample_data_CO1, aes(x = plate_col_CO1, y = plate_row_CO1)) +
  geom_tile(aes(fill = sampleType), color = "white", alpha = 0.7) +
  geom_point(aes(size = depth), shape = 21, fill = "black", color = "black") + # Fill circles with black
  scale_fill_manual(values = c("field-control" = "brown", 
                               "lab-extraction-control" = "red",
                               "lab-negative-control" = "pink", 
                               "lab-positive-control" = "seagreen",
                               "sample" ="white", 
                               "plate-replicate" = "lightblue", 
                               "failed-repeat" = "white", 
                               "run-replicate" = "lightblue4")) + 
  scale_size_continuous(range = c(2, 10)) +  # Adjust circle sizes as needed
  labs(title = "Virtual PCR Plates",
       x = NULL,
       y = NULL,
       fill = "Control Type",
       size = "# of reads per sample") +
  theme_bw() +
  theme(legend.position = "right") + # Adjust legend position if needed
  facet_wrap(~ batch_PCR_CO1, ncol = 2, scales = "free") + # Facet by plate variable, 2 plates per row
  scale_x_continuous(breaks = 1:12)  # Discrete x-axis from 1 to 12

pcr_plate_CO1

And now for 18S.

# Filter out NA values
sample_data_18S <- sample_data[!is.na(sample_data$plate_row_18S), ]

# Reorder levels of plate_row_18S
sample_data_18S$plate_row_18S <- factor(sample_data_18S$plate_row_18S, levels = rev(LETTERS[1:8]))

# Relabel PCR plates
sample_data_18S$batch_PCR_18S <- recode(sample_data_18S$batch_PCR_18S,
                                    "1" = "SW-CO1",
                                    "2" = "SCH-CO1",
                                    "3" = "SW-18S",
                                    "4" = "SCH-18S",
                                    "5" = "NW-18S",
                                    "6" = "NE-18S",
                                    "7" = "CN-18S",
                                    "8" = "NW-CO1",
                                    "9" = "NE-CO1",
                                    "10" = "CN-CO1")

# Plot with facet_wrap and circles representing concentrations - 18S first
pcr_plate_18S <- ggplot(sample_data_18S, aes(x = plate_col_18S, y = plate_row_18S)) +
  geom_tile(aes(fill = sampleType), color = "white", alpha = 0.7) +
  geom_point(aes(size = depth), shape = 21, fill = "black", color = "black") + # Fill circles with black
  scale_fill_manual(values = c("field-control" = "brown", 
                               "lab-extraction-control" = "red",
                               "lab-negative-control" = "pink", 
                               "lab-positive-control" = "seagreen",
                               "sample" ="white", 
                               "plate-replicate" = "lightblue", 
                               "failed-repeat" = "white", 
                               "run-replicate" = "lightblue4")) + 
  scale_size_continuous(range = c(2, 10)) +  # Adjust circle sizes as needed
  labs(title = "Virtual PCR Plates",
       x = NULL,
       y = NULL,
       fill = "Control Type",
       size = "# of reads per sample") +
  theme_bw() +
  theme(legend.position = "right") + # Adjust legend position if needed
  facet_wrap(~ batch_PCR_18S, ncol = 2, scales = "free") + # Facet by plate variable, 2 plates per row
  scale_x_continuous(breaks = 1:12)  # Discrete x-axis from 1 to 12

pcr_plate_18S

Removing contaminants

We can see from our plots we have some contamination. We deal with this next.

There are multiple ways to deal with contamination. Here, we take the approach that if the abundance of a taxa in control sample is larger than abundance in main sample, it will be treated as contaminant and be removed.

We’ll remove taxa in stages: from sites (using the field controls), extraction batch (using the extraction controls) then PCR batch (using the PCR controls). This prevents unnecessary blanket removal across the whole data set.

Let’s set-up the site level decontamination function called remove_field_control_taxa_abund first.

remove_field_control_taxa_abund <- function(phylo_object) {
  
  # Extract sample data
  sample_data <- sample_data(phylo_object)
  
  # Get unique localityIDs
  unique_localityIDs <- unique(sample_data$localityID[!is.na(sample_data$localityID)])
  
  # Check if unique_localityIDs is empty
  if (length(unique_localityIDs) == 0) {
    stop("No localityIDs found in sample data.")
  }
  
  # Initialize variable to count OTUs removed
  otus_removed <- data.frame(localityID = character(), OTU = character(), reads_removed = integer(), stringsAsFactors = FALSE)
  
  # Initialize filtered OTU table
  otu_table_filtered <- otu_table(phylo_object)
  
  # Check if the OTU table is empty
  if (dim(otu_table_filtered)[1] == 0 || dim(otu_table_filtered)[2] == 0) {
    stop("OTU abundance data is empty.")
  }
  
  print("Original dimensions of otu_table_filtered:")
  print(dim(otu_table_filtered))
  
  # Initialize list to store removed OTUs for each sample
  otus_removed_reads <- data.frame()
  otus_removed_reads_total <- data.frame()
  
  # Loop through each localityID
  for (locality in unique_localityIDs) {
    
    # Get field control sample fullIDs for the current locality
    field_control_samples <- unique(sample_data$fullID[sample_data$localityID == locality & grepl("-C_CO1$|-C_18S$", sample_data$fullID)])
    
    # If there are more than 2 field control samples for the current locality, print a message and skip
    if (length(field_control_samples) > 2) {
      cat("More than 1 field control samples found for site:", locality, "\n")
      next
    }
    
    # If there are no field control samples for the current locality, print a message and skip
    if (length(field_control_samples) < 2) {
      cat("No field control samples found for site:", locality, "\n")
      next
    }
    
    # Get indices of field control and samples
    control_indices <- which(sample_data$fullID %in% field_control_samples)
    sample_indices <- which(sample_data$localityID == locality & !sample_data$fullID %in% field_control_samples)
    
    # If no control indices found
    if (length(control_indices) == 0) {
      cat("No control indices found for site:", locality, "\n")
      next
    }
    
    # If no sample indices found
    if (length(sample_indices) == 0) {
      cat("No sample indices found for site:", locality, "\n")
      next
    }
    
    # Calculate mean abundance of each OTU in the control and samples
    control_abundance <- rowMeans(otu_table_filtered[, control_indices])
    sample_abundance <- rowMeans(otu_table_filtered[, sample_indices])
    
    # Identify potential contaminants based on higher abundance in control than samples
    contaminants <- rownames(otu_table_filtered)[control_abundance > sample_abundance]
    
    if (length(contaminants) > 0) {
      cat(length(contaminants), "contaminant taxa found for site:", locality, "\n")
    } else {
      cat("No contaminants found for site:", locality, "\n")
      next
    }
    
    #Get original number of reads in samples for taxa with above minReads reads in controls
    #bind the previous output
    if (length(otus_removed_reads) > 0) {
      otus_removed_reads_total <- rbind(otus_removed_reads, otus_removed_reads_total)
    }
    
    #get reads
    otus_removed_reads <- otu_table_filtered[contaminants,  sample_indices] %>% reshape2::melt()
    colnames(otus_removed_reads) <- c("taxa", "fullID", "reads_removed")
    
    # Set read count of OTUs in real samples to zero if reads in field control samples exceed 100
    otu_table_filtered[contaminants, sample_indices] <- 0
    
  }
  
  # Print OTUs removed
  cat("Reads removed:", sum(otus_removed_reads_total$reads_removed),"; Samples filtered:", length(unique(otus_removed_reads_total$fullID)), "\n")
  
  # Print new dimensions
  print("New dimensions of otu_table_filtered:")
  print(dim(otu_table_filtered))
  
  # Remove controls from the dataset
  control_samples<- sample_data$fullID[grepl("-C_CO1$|-C_18S$", sample_data$fullID)] # Build list of names of control samples
  otu_table_filtered <- otu_table_filtered[, -which(colnames(otu_table_filtered) %in% control_samples)] # Remove control samples from otu_table
  sample_data_filtered <- sample_data[!sample_data$fullID %in% control_samples, ] # Remove control samples from sample_data
  
  # Return the modified phyloseq object
  modified_phylo <- phyloseq(otu_table_filtered, tax_table(phylo_object), sample_data_filtered)
  
  # Remove taxa with zero reads removed in otus_removed_reads_total
  otus_removed_reads_total <- otus_removed_reads_total %>% subset(otus_removed_reads_total$reads_removed != 0)
  
  # Return the modified phyloseq object and otus_removed dataframe
  return(list(modified_phylo, otus_removed_reads_total))
}

Next, the function for extraction level decontamination called remove_extract_control_taxa_abund.

#| label: remove-extract-contam-function

remove_extract_control_taxa_abund <- function(phylo_object) {
  
  # Extract sample data
  sample_data <- sample_data(phylo_object)
  
  # Get unique batches
  unique_batches <- unique(sample_data$batch_extraction[!is.na(sample_data$batch_extraction)])
  
  # Check if unique_localityIDs is empty
  if (length(unique_batches) == 0) {
    stop("No DNA extraction batches found in sample data.")
  }
  
  # Initialize variable to count OTUs removed
  otus_removed <- data.frame(batch = character(), OTU = character(), reads_removed = integer(), stringsAsFactors = FALSE)
  
  # Initialize filtered OTU table
  otu_table_filtered <- otu_table(phylo_object)
  
  # Check if the OTU table is empty
  if (dim(otu_table_filtered)[1] == 0 || dim(otu_table_filtered)[2] == 0) {
    stop("OTU abundance data is empty.")
  }
  
  print("Original dimensions of otu_table_filtered:")
  print(dim(otu_table_filtered))
  
  # Initialize list to store removed OTUs for each sample
  otus_removed_reads <- data.frame()
  otus_removed_reads_total <- data.frame()
  
  # Loop through each localityID
  for (batch in unique_batches) {
    
    # Get extract control sample for the current batch
    dna_extract_control_samples <- unique(sub("_[^_]*$", "", sample_data$fullID[sample_data$sampleType == "lab-extraction-control" 
                                                                                & sample_data$batch_extraction == batch]))
    
    # If there are more than 2 field control samples for the current locality, print a message and skip
    if (length(dna_extract_control_samples) > 2) {
      cat("More than 1 DNA extract control sample found in batch:", batch, "\n")
      next
    }
    
    # If there are no field control samples for the current locality, print a message and skip
    if (length(dna_extract_control_samples) < 1) {
      cat("No DNA extract control samples found in batch:", batch, "\n")
      next
    }
    
    # Get indices of dna extract control and samples
    control_indices <- which(sample_data$fieldID %in% dna_extract_control_samples)
    sample_indices <- which(sample_data$batch_extraction == batch & !sample_data$fullID %in% dna_extract_control_samples)
    
    # If no control indices found
    if (length(control_indices) == 0) {
      cat("No control indices found for batch:", batch, "\n")
      next
    }
    
    # If no sample indices found
    if (length(sample_indices) == 0) {
      cat("No sample indices found for batch:", batch, "\n")
      next
    }
    
    # Calculate mean abundance of each OTU in the control and samples
    control_abundance <- rowMeans(otu_table_filtered[, control_indices])
    sample_abundance <- rowMeans(otu_table_filtered[, sample_indices])
    
    # Identify potential contaminants based on higher abundance in control than samples
    contaminants <- rownames(otu_table_filtered)[control_abundance > sample_abundance]
    
    if (length(contaminants) > 0) {
      cat(length(contaminants), "contaminant taxa found for site:", batch, "\n")
    } else {
      cat("No contaminants found for site:", batch, "\n")
      next
    }
    
    #Get original number of reads in samples for taxa with above minReads reads in controls
    #bind the previous output
    if (length(otus_removed_reads) > 0) {
      otus_removed_reads_total <- rbind(otus_removed_reads, otus_removed_reads_total)
    }
    
    #get reads
    otus_removed_reads <- otu_table_filtered[contaminants,  sample_indices] %>% reshape2::melt()
    colnames(otus_removed_reads) <- c("taxa", "fullID", "reads_removed")
    
    # Set read count of OTUs in real samples to zero if reads in field control samples exceed 100
    otu_table_filtered[contaminants, sample_indices] <- 0
    
    # Remove the control samples from the phylo object
    otu_table_filtered <- otu_table_filtered[-control_indices]
    
  }
  
  # Print OTUs removed
  cat("Reads removed:", sum(otus_removed_reads_total$reads_removed),"; Samples filtered:", length(unique(otus_removed_reads_total$fullID)), "\n")
  
  # Remove controls from the dataset
  control_samples <- unique(sub("_[^_]*$", "", sample_data$fullID[sample_data$sampleType == "lab-extraction-control"])) # Build list of names of control samples
  control_samples <- c(paste0(control_samples, "_CO1"), paste0(control_samples, "_18S"))  # Create a list of control samples by appending "_CO1" and "_18S" to each ID
  otu_table_filtered <- otu_table_filtered[, -which(colnames(otu_table_filtered) %in% control_samples)] # Remove control samples from otu_table
  sample_data_filtered <- sample_data[!sample_data$fullID %in% control_samples, ] # Remove control samples from sample_data
  
  # Print new dimensions
  print("New dimensions of otu_table_filtered:")
  print(dim(otu_table_filtered))
  
  # Return the modified phyloseq object
  modified_phylo <- phyloseq(otu_table_filtered, tax_table(phylo_object), sample_data_filtered)
  
  # Remove taxa with zero reads removed in otus_removed_reads_total
  otus_removed_reads_total <- otus_removed_reads_total %>% subset(otus_removed_reads_total$reads_removed != 0)
  
  # Return the modified phyloseq object and otus_removed data frame
  return(list(modified_phylo, otus_removed_reads_total))
}

And finally, the function for PCR level decontamination. We have to do this by marker, considering the PCRs are different for each.

The 18S function is called remove_PCR_control_taxa_18S_abund.

#| label: remove-PCR18S-contam-function

remove_PCR_control_taxa_18S_abund <- function(phylo_object) {
  
  # Extract sample data
  sample_data <- sample_data(phylo_object)
  
  # Get unique batches
  unique_batches <- unique(sample_data$batch_PCR_18S[!is.na(sample_data$batch_PCR_18S)])
  
  # Check if unique_localityIDs is empty
  if (length(unique_batches) == 0) {
    stop("No PCR (18S) batches found in sample data.")
  }
  
  # Initialize variable to count OTUs removed
  otus_removed <- data.frame(batch = character(), OTU = character(), reads_removed = integer(), stringsAsFactors = FALSE)
  
  # Initialize filtered OTU table
  otu_table_filtered <- otu_table(phylo_object)
  
  # Check if the OTU table is empty
  if (dim(otu_table_filtered)[1] == 0 || dim(otu_table_filtered)[2] == 0) {
    stop("OTU abundance data is empty.")
  }
  
  print("Original dimensions of otu_table_filtered:")
  print(dim(otu_table_filtered))
  
  # Initialize list to store removed OTUs for each sample
  otus_removed_reads <- data.frame()
  otus_removed_reads_total <- data.frame()
  
  # Loop through each batch_PCR_18S
  for (batch in unique_batches) {
    
    # Get extract control samples for the current batch
    pcr_18S_control_samples <- unique(sub("_[^_]*$", "", sample_data$fullID[sample_data$sampleType == "lab-negative-control" 
                                                                            & sample_data$batch_PCR_18S == batch]))
    pcr_18S_control_samples <- na.omit(pcr_18S_control_samples)
    
    # If there are no PCR 18S control samples for the current batch, print a message and skip
    if (length(pcr_18S_control_samples) < 1) {
      cat("No PCR (18S) control samples found in batch:", batch, "\n")
      next
    }
    
    # Get indices of PCR (18S) control and samples
    control_indices <- which(sample_data$fieldID %in% pcr_18S_control_samples)
    sample_indices <- which(sample_data$batch_PCR_18S == batch & !sample_data$fullID %in% pcr_18S_control_samples)
    
    # If no control indices found
    if (length(control_indices) == 0) {
      cat("No control indices found for batch:", batch, "\n")
      next
    }
    
    # If no sample indices found
    if (length(sample_indices) == 0) {
      cat("No sample indices found for batch:", batch, "\n")
      next
    }
    
    # If there are more than PCR 18S control samples for the current locality, loop through the controls
    if (length(pcr_18S_control_samples) > 2) {
      cat("More than 1 PCR (18S) control sample found in batch", batch, ". Now printing individual controls:", "\n")
      
      for (control in control_indices) {
        
        # Calculate mean abundance of each OTU in the control and samples
        control_abundance <- rowMeans(otu_table_filtered[, control])
        sample_abundance <- rowMeans(otu_table_filtered[, sample_indices])
        
        #check there are OTUs with reads above minReads in the field control samples
        control_sum_above_minReads <- rowSums(otu_table_filtered[, control]) > 100
        
        if (any(control_sum_above_minReads)) {
          contaminants <- rownames(otu_table_filtered[control_abundance > sample_abundance])
          cat("Batch", batch, ":", sum(control_sum_above_minReads == T), "contaminant taxa found for control indices", control, "\n")
        } else {
          cat("Batch", batch, ": No contaminants found for control indices", control, "\n")
          next
        }
        
        #Get original number of reads in samples for taxa with above minReads reads in controls
        #bind the previous output
        if (length(otus_removed_reads) > 0) {
          otus_removed_reads_total <- rbind(otus_removed_reads, otus_removed_reads_total)
        }
        
        #get reads
        otus_removed_reads <- otu_table_filtered[contaminants,  sample_indices] %>% reshape2::melt()
        colnames(otus_removed_reads) <- c("taxa", "fullID", "reads_removed")
        
        # Set read count of OTUs in real samples to zero if reads in field control samples exceed 100
        otu_table_filtered[contaminants, sample_indices] <- 0
        
        # Remove the control samples from the phylo object
        otu_table_filtered <- otu_table_filtered[-control]
      }
    } else {
      
      #check there are OTUs with reads above minReads in the field control samples
      control_sum_above_minReads <- rowSums(otu_table_filtered[, control_indices]) > minReads
      
      if (any(control_sum_above_minReads)) {
        contaminants <- rownames(otu_table_filtered[rowSums(otu_table_filtered[, control_indices]) > minReads])
        cat(sum(control_sum_above_minReads == T), "contaminant taxa found for batch", batch, "\n")
      } else {
        cat("No contaminants found for batch", batch, "\n")
        next
      }
      
      #Get original number of reads in samples for taxa with above minReads reads in controls
      #bind the previous output
      if (length(otus_removed_reads) > 0) {
        otus_removed_reads_total <- rbind(otus_removed_reads, otus_removed_reads_total)
      }
      
      #get reads
      otus_removed_reads <- otu_table_filtered[contaminants,  sample_indices] %>% reshape2::melt()
      colnames(otus_removed_reads) <- c("taxa", "fullID", "reads_removed")
      
      # Set read count of OTUs in real samples to zero if reads in field control samples exceed 100
      otu_table_filtered[contaminants, sample_indices] <- 0
      
      # Remove the control samples from the phylo object
      otu_table_filtered <- otu_table_filtered[-control_indices]
    }
  }
  
  # Print OTUs removed
  cat("Reads removed:", sum(otus_removed_reads_total$reads_removed),"; Samples filtered:", length(unique(otus_removed_reads_total$fullID)), "\n")
  
  # Get list of control samples
  control_samples <- unique(sub("_[^_]*$", "", sample_data$fullID[sample_data$sampleType == "lab-negative-control"])) # Build list of names of control samples
  control_samples <- c(paste0(control_samples, "_18S")) # Create a list of control samples by appending "_CO1" to each ID
  
  # Check control samples to filtered otu table (will be more in the list than reality because some aren't _CO1)
  print(control_samples)
  print(which(control_samples %in% colnames(otu_table_filtered)))
  
  # Remove control samples from otu and sample table
  otu_table_filtered <- otu_table_filtered[, -which(colnames(otu_table_filtered) %in% control_samples)] # Remove control samples from otu_table
  sample_data_filtered <- sample_data[!sample_data$fullID %in% control_samples, ] # Remove control samples from sample_data
  
  # Print new dimensions
  print("New dimensions of otu_table_filtered:")
  print(dim(otu_table_filtered))
  
  # Return the modified phyloseq object
  modified_phylo <- phyloseq(otu_table_filtered, tax_table(phylo_object), sample_data_filtered)
  
  # Remove taxa with zero reads removed in otus_removed_reads_total
  otus_removed_reads_total <- otus_removed_reads_total %>% subset(otus_removed_reads_total$reads_removed != 0)
  
  # Return the modified phyloseq object and otus_removed dataframe
  return(list(modified_phylo, otus_removed_reads_total))
}

And the CO1 function is called remove_PCR_control_taxa_CO1_abund.

### PCR negative decontamination (CO1)
remove_PCR_control_taxa_CO1_abund <- function(phylo_object) {
  
  # Extract sample data
  sample_data <- sample_data(phylo_object)
  
  # Get unique batches
  unique_batches <- unique(sample_data$batch_PCR_CO1[!is.na(sample_data$batch_PCR_CO1)])
  
  # Check if unique_localityIDs is empty
  if (length(unique_batches) == 0) {
    stop("No PCR (CO1) batches found in sample data.")
  }
  
  # Initialize variable to count OTUs removed
  otus_removed <- data.frame(batch = character(), OTU = character(), reads_removed = integer(), stringsAsFactors = FALSE)
  
  # Initialize filtered OTU table
  otu_table_filtered <- otu_table(phylo_object)
  
  # Check if the OTU table is empty
  if (dim(otu_table_filtered)[1] == 0 || dim(otu_table_filtered)[2] == 0) {
    stop("OTU abundance data is empty.")
  }
  
  print("Original dimensions of otu_table_filtered:")
  print(dim(otu_table_filtered))
  
  # Initialize list to store removed OTUs for each sample
  otus_removed_reads <- data.frame()
  otus_removed_reads_total <- data.frame()
  
  # Loop through each batch_PCR_CO1
  for (batch in unique_batches) {
    
    # Get extract control samples for the current batch
    pcr_CO1_control_samples <- unique(sub("_[^_]*$", "", sample_data$fullID[sample_data$sampleType == "lab-negative-control" 
                                                                            & sample_data$batch_PCR_CO1 == batch]))
    pcr_CO1_control_samples <- na.omit(pcr_CO1_control_samples)
    
    # If there are no PCR CO1 control samples for the current batch, print a message and skip
    if (length(pcr_CO1_control_samples) < 1) {
      cat("No PCR (CO1) control samples found in batch:", batch, "\n")
      next
    }
    
    # Get indices of PCR (CO1) control and samples
    control_indices <- which(sample_data$fieldID %in% pcr_CO1_control_samples)
    sample_indices <- which(sample_data$batch_PCR_CO1 == batch & !sample_data$fullID %in% pcr_CO1_control_samples)
    
    # If no control indices found
    if (length(control_indices) == 0) {
      cat("No control indices found for batch:", batch, "\n")
      next
    }
    
    # If no sample indices found
    if (length(sample_indices) == 0) {
      cat("No sample indices found for batch:", batch, "\n")
      next
    }
    
    # If there are more than PCR CO1 control samples for the current locality, loop through the controls
    if (length(pcr_CO1_control_samples) > 2) {
      cat("More than 1 PCR (CO1) control sample found in batch", batch, ". Now printing individual controls:", "\n")
      
      for (control in control_indices) {
        
        # Calculate mean abundance of each OTU in the control and samples
        control_abundance <- rowMeans(otu_table_filtered[, control])
        sample_abundance <- rowMeans(otu_table_filtered[, sample_indices])
        
        #check there are OTUs with reads above minReads in the field control samples
        control_sum_above_minReads <- rowSums(otu_table_filtered[, control]) > 100
        
        if (any(control_sum_above_minReads)) {
          if (any(control_abundance > sample_abundance)) {
            contaminants <- rownames(otu_table_filtered[control_abundance > sample_abundance])
            cat("Batch", batch, ":", sum(control_sum_above_minReads == TRUE), "contaminant taxa found for control indices", control, "\n")
          } else {
            cat("Batch", batch, ": Control abundance is not greater than sample abundance. OTU table would be empty.\n")
            next
          }
        } else {
          cat("Batch", batch, ": No contaminants found for control indices", control, "\n")
          next
        }
        
        #Get original number of reads in samples for taxa with above minReads reads in controls
        #bind the previous output
        if (length(otus_removed_reads) > 0) {
          otus_removed_reads_total <- rbind(otus_removed_reads, otus_removed_reads_total)
        }
        
        #get reads
        otus_removed_reads <- otu_table_filtered[contaminants,  sample_indices] %>% reshape2::melt()
        colnames(otus_removed_reads) <- c("taxa", "fullID", "reads_removed")
        
        # Set read count of OTUs in real samples to zero if reads in field control samples exceed 100
        otu_table_filtered[contaminants, sample_indices] <- 0
        
        # Remove the control samples from the phylo object
        otu_table_filtered <- otu_table_filtered[-control]
      }
    } else {
      
      #check there are OTUs with reads above minReads in the field control samples
      control_sum_above_minReads <- rowSums(otu_table_filtered[, control_indices]) > minReads
      
      if (any(control_sum_above_minReads)) {
        contaminants <- rownames(otu_table_filtered[rowSums(otu_table_filtered[, control_indices]) > minReads])
        cat(sum(control_sum_above_minReads == T), "contaminant taxa found for batch", batch, "\n")
      } else {
        cat("No contaminants found for batch", batch, "\n")
        next
      }
      
      #Get original number of reads in samples for taxa with above minReads reads in controls
      #bind the previous output
      if (length(otus_removed_reads) > 0) {
        otus_removed_reads_total <- rbind(otus_removed_reads, otus_removed_reads_total)
      }
      
      #get reads
      otus_removed_reads <- otu_table_filtered[contaminants,  sample_indices] %>% reshape2::melt()
      colnames(otus_removed_reads) <- c("taxa", "fullID", "reads_removed")
      
      # Set read count of OTUs in real samples to zero if reads in field control samples exceed 100
      otu_table_filtered[contaminants, sample_indices] <- 0
      
      # Remove the control samples from the phylo object
      otu_table_filtered <- otu_table_filtered[-control_indices]
    }
  }
  
  # Print OTUs removed
  cat("Reads removed:", sum(otus_removed_reads_total$reads_removed),"; Samples filtered:", length(unique(otus_removed_reads_total$fullID)), "\n")
  
  # Get list of control samples
  control_samples <- unique(sub("_[^_]*$", "", sample_data$fullID[sample_data$sampleType == "lab-negative-control"])) # Build list of names of control samples
  control_samples <- c(paste0(control_samples, "_CO1")) # Create a list of control samples by appending "_CO1" to each ID
  
  # Check control samples to filtered otu table (will be more in the list than reality because some aren't _CO1)
  print(control_samples)
  print(which(control_samples %in% colnames(otu_table_filtered)))
  
  # Remove control samples from otu and sample table
  otu_table_filtered <- otu_table_filtered[, -which(colnames(otu_table_filtered) %in% control_samples)] # Remove control samples from otu_table
  sample_data_filtered <- sample_data[!sample_data$fullID %in% control_samples, ] # Remove control samples from sample_data
  
  # Print new dimensions
  print("New dimensions of otu_table_filtered:")
  print(dim(otu_table_filtered))
  
  # Return the modified phyloseq object
  modified_phylo <- phyloseq(otu_table_filtered, tax_table(phylo_object), sample_data_filtered)
  
  # Remove taxa with zero reads removed in otus_removed_reads_total
  otus_removed_reads_total <- otus_removed_reads_total %>% subset(otus_removed_reads_total$reads_removed != 0)
  
  # Return the modified phyloseq object and otus_removed data frame
  return(list(modified_phylo, otus_removed_reads_total))
}

Time to run the decontamination functions one after the other, using the output of the first as the input for the last.

#| label: call-decontam-funcions

minReads = 100 #to identify a contaminant

#Call remove_field_control_taxa_abund() function (site)
result_field_abun <- remove_field_control_taxa_abund(phylo_eDNA)
[1] "Original dimensions of otu_table_filtered:"
[1] 1725  655
1 contaminant taxa found for site: SCH01 
4 contaminant taxa found for site: SCH02 
1 contaminant taxa found for site: SCH03 
No contaminants found for site: SCH04 
2 contaminant taxa found for site: SCH05 
3 contaminant taxa found for site: SCH06 
1 contaminant taxa found for site: SCH07 
1 contaminant taxa found for site: SCH08 
2 contaminant taxa found for site: SW01 
2 contaminant taxa found for site: SW02 
1 contaminant taxa found for site: SW03 
7 contaminant taxa found for site: SW04 
1 contaminant taxa found for site: SW05 
No field control samples found for site: SW06 
2 contaminant taxa found for site: SW07 
1 contaminant taxa found for site: SW08 
73 contaminant taxa found for site: CN01 
6 contaminant taxa found for site: CN02 
45 contaminant taxa found for site: CN03 
17 contaminant taxa found for site: CN04 
8 contaminant taxa found for site: CN05 
5 contaminant taxa found for site: NE01 
2 contaminant taxa found for site: NE02 
3 contaminant taxa found for site: NE03 
5 contaminant taxa found for site: NE04 
8 contaminant taxa found for site: NE05 
No field control samples found for site: NW01 
2 contaminant taxa found for site: NW02 
6 contaminant taxa found for site: NW03 
3 contaminant taxa found for site: NW04 
3 contaminant taxa found for site: NW05 
1 contaminant taxa found for site: NW06 
Reads removed: 60165 ; Samples filtered: 474 
[1] "New dimensions of otu_table_filtered:"
[1] 1725  655
phylo_eDNA_filtered_field_abun <- result_field_abun[[1]]
otus_removed_field_abun <- result_field_abun[[2]]

#Call remove_extract_control_taxa_abund() function (extracts)
result_extract_abun <- remove_extract_control_taxa_abund(phylo_eDNA_filtered_field_abun)
[1] "Original dimensions of otu_table_filtered:"
[1] 1725  594
1 contaminant taxa found for site: 1 
4 contaminant taxa found for site: 2 
2 contaminant taxa found for site: 3 
2 contaminant taxa found for site: 4 
3 contaminant taxa found for site: 5 
6 contaminant taxa found for site: 6 
69 contaminant taxa found for site: 9 
6 contaminant taxa found for site: 10 
10 contaminant taxa found for site: 8 
5 contaminant taxa found for site: 7 
Reads removed: 608314 ; Samples filtered: 497 
[1] "New dimensions of otu_table_filtered:"
[1] 1705  574
phylo_eDNA_filtered_extract_abun <- result_extract_abun[[1]]
otus_removed_extract_abun <- result_extract_abun[[2]]

#Call remove_PCR_CO1_control_taxa_abund() function (PCR)
result_PCR_CO1_abun <- remove_PCR_control_taxa_CO1_abund(phylo_eDNA_filtered_extract_abun)
[1] "Original dimensions of otu_table_filtered:"
[1] 1705  574
More than 1 PCR (CO1) control sample found in batch 1 . Now printing individual controls: 
Batch 1 : No contaminants found for control indices 1 
Batch 1 : 1 contaminant taxa found for control indices 2 
Batch 1 : No contaminants found for control indices 3 
Batch 1 : No contaminants found for control indices 215 
1 contaminant taxa found for batch 2 
More than 1 PCR (CO1) control sample found in batch 10 . Now printing individual controls: 
Batch 10 : 4 contaminant taxa found for control indices 411 
Batch 10 : 8 contaminant taxa found for control indices 412 
Batch 10 : 20 contaminant taxa found for control indices 413 
Batch 10 : No contaminants found for control indices 414 
Batch 10 : 2 contaminant taxa found for control indices 415 
Batch 10 : No contaminants found for control indices 549 
No contaminants found for batch 9 
No contaminants found for batch 8 
Reads removed: 2461106 ; Samples filtered: 344 
 [1] "PHD1-NCbead_CO1"         "PHD1-NCrep_CO1"         
 [3] "PHD1-SCHNC-PCR_1703_CO1" "PHD1-SCHNC-PCR_2703_CO1"
 [5] "PHD1-SCHNC2803_CO1"      "PHD1-SWNC_PCR_2203_CO1" 
 [7] "PHD1-SWNC_PCR_2803_CO1"  "PHD2-Neg-PCR-0111_CO1"  
 [9] "PHD2-Neg-PCR-0311_CO1"   "PHD2-Neg-PCR-0611_CO1"  
[11] "PHD2-Neg-PCR-1411_CO1"   "PHD2-Neg-PCR-1511_CO1"  
[13] "PHD2-Neg-PCR-2011_CO1"   "PHD2-Neg-PCR-2111_CO1"  
[15] "PHD2-Neg-PCR-3010_CO1"   "PHD2-Neg-PCR-3110_CO1"  
[17] "PHD2-SCHNC2303_CO1"     
 [1]  1  2  3  5  6 10 11 12 13 14 17
[1] "New dimensions of otu_table_filtered:"
[1] 1698  563
phylo_eDNA_filtered_PCR_CO1_abun <- result_PCR_CO1_abun[[1]]
otus_removed_PCR_CO1_abun <- result_PCR_CO1_abun[[2]]

#all remove_PCR_18S_control_taxa_abund() function (PCR)
result_PCR_18S_abun <- remove_PCR_control_taxa_18S_abund(phylo_eDNA_filtered_PCR_CO1_abun)
[1] "Original dimensions of otu_table_filtered:"
[1] 1698  563
2 contaminant taxa found for batch 3 
No contaminants found for batch 4 
2 contaminant taxa found for batch 7 
5 contaminant taxa found for batch 6 
More than 1 PCR (18S) control sample found in batch 5 . Now printing individual controls: 
Batch 5 : 4 contaminant taxa found for control indices 403 
Batch 5 : No contaminants found for control indices 404 
Batch 5 : No contaminants found for control indices 406 
Reads removed: 1207399 ; Samples filtered: 297 
[1] "PHD1-NCrep_18S"          "PHD1-SCHNC-PCR_2703_18S"
[3] "PHD1-SWNC_PCR_2803_18S"  "PHD2-Neg-PCR-0111_18S"  
[5] "PHD2-Neg-PCR-0311_18S"   "PHD2-Neg-PCR-1511_18S"  
[7] "PHD2-Neg-PCR-2011_18S"   "PHD2-Neg-PCR-3010_18S"  
[9] "PHD2-Neg-PCR-3110_18S"  
[1] 1 2 3 4 5 6 7 8 9
[1] "New dimensions of otu_table_filtered:"
[1] 1692  554
phylo_eDNA_filtered_PCR_18S_abun <- result_PCR_18S_abun[[1]]
otus_removed_PCR_18S_abun <- result_PCR_18S_abun[[2]]

# rename file data
phylo_eDNA_decontam <- phylo_eDNA_filtered_PCR_18S_abun

# remove taxa with no reads across all samples
phylo_eDNA_decontam <- subset_taxa(phylo_eDNA_decontam, taxa_sums(phylo_eDNA_decontam) > 0)

Let’s compared our decontaminated data with the original.

We can see that control samples have now been removed from the data and 51 taxa have also been removed.

#| label: view-change-decontamination

phylo_eDNA
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 1725 taxa and 655 samples ]
sample_data() Sample Data:       [ 655 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 1725 taxa by 13 taxonomic ranks ]
phylo_eDNA_decontam
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 1674 taxa and 554 samples ]
sample_data() Sample Data:       [ 554 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 1674 taxa by 13 taxonomic ranks ]

We can also check to see how many samples are categorized under different sample types.

#| label: view-change-decontamination-samples

table(meta(phylo_eDNA_decontam)$sampleType, useNA = "always") #sample type

       failed-repeat lab-positive-control      plate-replicate 
                   6                   30                   34 
       run-replicate               sample                 <NA> 
                  32                  452                    0 
table(meta(phylo_eDNA_decontam)$controlCheck, useNA = "always") #control type

positive   sample     <NA> 
      30      524        0 
table(meta(phylo_eDNA_decontam)$shorePosition, useNA = "always") #shore height

    High      Low      Mid Subtidal    Tidal     <NA> 
     164      128       11        6      215       30 

We need to tidy up the shore positions to high, low and open water only.

#| label: tody-shore-height-names

sample_data(phylo_eDNA_decontam)$shorePosition[sample_data(phylo_eDNA_decontam)$shorePosition == "Mid "] <- "High"
sample_data(phylo_eDNA_decontam)$shorePosition[sample_data(phylo_eDNA_decontam)$shorePosition == "Tidal"] <- "Open Water"
sample_data(phylo_eDNA_decontam)$shorePosition[sample_data(phylo_eDNA_decontam)$shorePosition == "Subtidal"] <- "Open Water"
sample_data(phylo_eDNA_decontam)$shorePosition[sample_data(phylo_eDNA_decontam)$shorePosition == "Mid"] <- "High"

table(meta(phylo_eDNA_decontam)$shorePosition, useNA = "always") #shore height

      High        Low Open Water       <NA> 
       175        128        221         30 

We also don’t require our positive controls now.

#| label: remove-positive-controls

phylo_eDNA_decontam <- subset_samples(phylo_eDNA_decontam, !(controlCheck == "positive")) 

table(meta(phylo_eDNA_decontam)$sampleType, useNA = "always") #sample type

  failed-repeat plate-replicate   run-replicate          sample            <NA> 
              6              34              32             452               0 

Filtering steps

Removal of low read samples

It’s good practice to remove any samples with the low read depth to prevent sampling bias driving ecological patterns. We are going to explore the distribution of read depths across samples to make a decision on a minimum depth threshold.

We first need to calculate read depth per sample.

#| label: calculate-read-depth-per-sample

# Number of reads per sample (before filtering)
sample_depths_decontam <- microbiome::readcount(phylo_eDNA_decontam) %>%
  as.data.frame() %>%
  tibble::rownames_to_column(var = "fullID")

colnames(sample_depths_decontam) <- c("fullID", "reads_prefilter")

# Calculate the total ASVs by counting the number of rows 
num_asvs_vec <- c(nrow(phyloseq::otu_table(phylo_eDNA_decontam)))  
names(num_asvs_vec)[1] <- "no.taxa" 
num_asvs_vec
no.taxa 
   1674 
# Total number asvs per sample 
asv_sum <- as.data.frame(colSums(phyloseq::otu_table(phylo_eDNA_decontam)!=0))  

#Extract sample meta data as a separate R object 
abundance_metadf <- phyloseq::sample_data(phylo_eDNA_decontam) 

#Check if vector of sample_depths & asv_sum has the same order as our metadata rows
identical(sample_depths_decontam$fullID,row.names(abundance_metadf)) 
[1] TRUE
identical(row.names(asv_sum),row.names(abundance_metadf))  
[1] TRUE
#Add sample depths and number of ASVs to metadata data frame 
abundance_metadf[,"depth"] <- sample_depths_decontam$reads_prefilter 
abundance_metadf[,"ASVs"] <- asv_sum

Check the distribution of sample reads.

#| label: read-depth-dist-samples

pcr_seq_depth_overall <- ggplot(abundance_metadf, aes(depth)) +
  geom_histogram(bins = 60, color = "grey36", fill = "white") +   
  geom_vline(xintercept = 3000, lty = 2,color = "orange") + # threshold
  scale_x_log10() +   
  labs(x = "# Reads", y = "# Samples") +
  theme_bw() +
  theme(panel.grid = element_blank())

pcr_seq_depth_overall 

Now let’s flag samples with an acceptable (TRUE) or unacceptable (FALSE) sequencing depth. We should aim to keep at least 90% of samples.

#| label: flag-low-read-depth

abundance_metadf$depth_ok <- ifelse(abundance_metadf$depth < 3000, F, T)

table(abundance_metadf$depth_ok[abundance_metadf$negCheckLogical=="FALSE"]) /
  nrow(abundance_metadf[abundance_metadf$negCheckLogical=="FALSE",])

     FALSE       TRUE 
0.03625954 0.96374046 

A minimum threshold of 3000 reads looks like it could work well. Let’s now filter our data set to remove any samples below 3000.

#| label: filter-reads

sample_depths_object <- sample_sums(phylo_eDNA_decontam) # Calculate sample sequencing depths
min_reads <- 3000 # Define the minimum read threshold

# Prune samples with fewer than 3000 reads
phylo_eDNA_decontam_filtered <- prune_samples(sample_depths_object >= min_reads, phylo_eDNA_decontam)

#Check the number of samples before and after filtering
cat("Number of samples before filtering:", nsamples(phylo_eDNA_decontam), "\n")
Number of samples before filtering: 524 
cat("Number of samples after filtering:", nsamples(phylo_eDNA_decontam_filtered), "\n") #removed 19 samples
Number of samples after filtering: 505 

Filtering for target functional groups (broad)

For this project, we were only interested in marine invertebrates and algae. So, we need to remove any other type of taxa. We’ll start with a broad removal, then focus on species phyla.

Let’s first examine what groups we have.

#| label: unique-functional-groups

unique(tax_table(phylo_eDNA_decontam_filtered)[, "adult"])
Taxonomy Table:     [22 taxa by 1 taxonomic ranks]:
                            adult          
Abra nitida                 "benthos"      
Acanthochiasmidae           "phytoplankton"
Acartia tonsa cryophylla    "mesoplankton" 
Acinetospora filamentosa    "macroalgae"   
Acoela                      "macrobenthos" 
Acremonium fuci             NA             
Alcyonium                   "megabenthos"  
Alexandrium andersonii      "mixoplankton" 
Alexandrium minutum         "microplankton"
Allas                       "zooplankton"  
Ameira scotti               "meiobenthos"  
Ammodytes marinus           "fish"         
Amphidiniopsis              "nanoplankton" 
Amphidiniopsis rotundata    "microbenthos" 
Archilopsis spinosa         "turbellaria"  
Aureococcus anophagefferens "algae"        
Bufo bufo                   "nekton"       
Calanus                     "macroplankton"
Crinoidea                   "epibenthos"   
Duboscquella                "plankton"     
Echinocardium cordatum      "endobenthos"  
Halodule uninervis          "phytobenthos" 

Define which groups not of interest.

#| label: unwanted-taxa-define

fish_and_small_stuff <- c("fish", 
                         "microplankton", 
                         "phytoplankton", 
                         "nanoplankton", 
                         "mixoplankton", 
                         "microbenthos")

other_unwanted_class <- c("Aves", 
                          "Mammalia", 
                          "Amphibia")

other_unwanted_order <- c("Squamata")

Now let’s remove them from the relevant groups.

#| label: unwanted-taxa-remove

phylo_eDNA_decontam_filtered <- subset_taxa(
  phylo_eDNA_decontam_filtered,
  !(adult %in% fish_and_small_stuff) & 
  !(class %in% other_unwanted_class) & 
  !(order %in% other_unwanted_order) 
)

# Rmove any taxa without occurances
phylo_eDNA_decontam_filtered <- subset_taxa(phylo_eDNA_decontam_filtered, taxa_sums(phylo_eDNA_decontam_filtered) > 0)

phylo_eDNA_decontam_filtered
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 1398 taxa and 505 samples ]
sample_data() Sample Data:       [ 505 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 1398 taxa by 13 taxonomic ranks ]

Filtering for target taxa (more specific)

Let’s define which phyla we are interested in.

#| label: target-taxa-define

target_phyla <-   c(
  "Acoela",
  "Amphioxus",
  "Annelida",
  "Arthropoda",
  "Brachiopoda",
  "Bryozoa",
  "Cephalochordata",
  "Chaetognatha",
  "Chlorophyta",
  "Chordata",
  "Cnidaria",
  "Crustacea",
  "Ctenophora",
  "Dinoflagellata",
  "Echiura",
  "Echinoderm",
  "Echinodermata",
  "Euglenophyta",
  "Gastrotricha",
  "Gnathostomulids",
  "Gyrista",
  "Hemichordata",
  "Kamptozoa",
  "Kinorhyncha",
  "Loricifera",
  "Mollusca",
  "Monogenea",
  "Myzostomida",
  "Nematoda",
  "Nemertinea",
  "Ochrophyta",
  "Orthonectida",
  "Phaeophyta",
  "Phoronida",
  "Placozoa",
  "Platyhelminthes",
  "Porifera",
  "Priapulida",
  "Pycnogonida",
  "Rhodophyta",
  "Sipunculida",
  "Thallophyta",
  "Tunicata",
  "Turbellaria",
  "Xenoturbella",
  "Xiphosura"
)

Now let’s remove everything other than target taxa from the data.

#| label: target-taxa-filter

phylo_eDNA_decontam_filtered <- subset_taxa(phylo_eDNA_decontam_filtered,                                              phylum %in% target_phyla)

# Rmove any taxa without occurances
phylo_eDNA_decontam_filtered <- subset_taxa(phylo_eDNA_decontam_filtered, taxa_sums(phylo_eDNA_decontam_filtered) > 0)
                                            
phylo_eDNA_decontam_filtered
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 1026 taxa and 505 samples ]
sample_data() Sample Data:       [ 505 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 1026 taxa by 13 taxonomic ranks ]

Let’s check to see how many taxa we have for invertebrates and macroalgae.

First, let’s define our groups.

#| label: target-taxa-define-invert-and-algae

invert_phyla <- c(
  "Acoela",
  "Amphioxus",
  "Annelida",
  "Arthropoda",
  "Brachiopoda",
  "Bryozoa",
  "Cephalochordata",
  "Chaetognatha",
  "Chordata",
  "Cnidaria",
  "Crustacea",
  "Echiura",
  "Echinoderm",
  "Echinodermata",
  "Gastrotricha",
  "Gnathostomulids",
  "Hemichordata",
  "Kamptozoa",
  "Kinorhyncha",
  "Loricifera",
  "Mollusca",
  "Monogenea",
  "Myzostomida",
  "Nematoda",
  "Nemertinea",
  "Orthonectida",
  "Phaeophyta",
  "Phoronida",
  "Placozoa",
  "Platyhelminthes",
  "Porifera",
  "Priapulida",
  "Pycnogonida",
  "Sipunculida",
  "Thallophyta",
  "Tunicata",
  "Xenoturbella",
  "Xiphosura"
)                    

algae_phyla <- c(
  "Chlorophyta",
  "Ctenophora",
  "Dinoflagellata",
  "Euglenophyta",
  "Gyrista",
  "Ochrophyta",
  "Phaeophyta",
  "Rhodophyta",
  "Thallophyta"
)

Let’s look at invertebrates first.

#| label: target-taxa-filter-invert

phylo_eDNA_decontam_filtered_invert <- subset_taxa(phylo_eDNA_decontam_filtered, phylum %in% invert_phyla)  

phylo_eDNA_decontam_filtered_invert   
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 737 taxa and 505 samples ]
sample_data() Sample Data:       [ 505 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 737 taxa by 13 taxonomic ranks ]
print(paste("Invertebrate species account for", (737 / 1026) * 100, "% of detections."))
[1] "Invertebrate species account for 71.8323586744639 % of detections."

Now let’s look at algae.

#| label: target-taxa-filter-algae

phylo_eDNA_decontam_filtered_algae <- subset_taxa(phylo_eDNA_decontam_filtered, phylum %in% algae_phyla)  

phylo_eDNA_decontam_filtered_algae  
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 289 taxa and 505 samples ]
sample_data() Sample Data:       [ 505 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 289 taxa by 13 taxonomic ranks ]
print(paste("Algae species account for", (289 / 1026) * 100, "% of detections."))
[1] "Algae species account for 28.1676413255361 % of detections."

Rarefying

Sometimes, we may want to rarefy our data.

#pseq_rarefy <- phyloseq::rarefy_even_depth(phylo_eDNA_decontam_filtered,
                                           #sample.size = #min(microbiome::readcount(phylo_eDNA_decontam_filtered)))

#pseq_rarefy
#microbiome::readcount(pseq_rarefy)

Save final datasets

We won’t be making anymore changes to our main data, so let’s export the phyloseq object to use elsewhere.

#| label: save-phylo

phylo_rocky_eDNA <- phylo_eDNA_decontam_filtered 

save(phylo_rocky_eDNA, file = "Processed_Data/phylo_rocky_eDNA.RData") #save object

And the rarefied data.

#| label: save-rarefied-phylo

#save(pseq_rarefy, file = "Processed_Data/phylo_rocky_eDNA_rarefied.RData") #save object

Let’s also convert it to a long data format in case we need it for further analyses.

#| label: save-long-format

#Extra elements and format
#OTU table
otu_table <- as.data.frame(otu_table(phylo_rocky_eDNA))
otu_table$taxa <- rownames(otu_table) 
rownames(otu_table) <- NULL
otu_long <- melt(otu_table, id.vars = c("taxa"))
colnames(otu_long) = c("taxa", "fullID", "reads")

# Taxonomic info
taxa_table <- as.data.frame(tax_table(phylo_rocky_eDNA))
taxa_table$taxa <- rownames(taxa_table)

# Meta data
sample_data <- data.frame(sample_data(phylo_rocky_eDNA))

# Merge
merged_data <- right_join(otu_long, sample_data, by = "fullID")
phylo_rocky_eDNA_long <- right_join(merged_data, taxa_table, by = "taxa")
phylo_rocky_eDNA_long$localityID <- as.factor(phylo_rocky_eDNA_long$localityID)

#save combined dataset 
write.csv(phylo_rocky_eDNA_long, "Processed_Data/phylo_rocky_eDNA_long.csv")

Further quality control

Now we’ve got our decontaminated and filtered data, we can do a variety of quality control checks to make sure everything looks like it should.

We have three phyloseq objects which we can explore in different ways: pre-decontamination, pre-filtering and post-processing (aka our final data).

phylo_eDNA_predecontam #pre-decontamination
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 1725 taxa and 655 samples ]
sample_data() Sample Data:       [ 655 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 1725 taxa by 13 taxonomic ranks ]
phylo_eDNA_decontam #pre-filtering
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 1674 taxa and 524 samples ]
sample_data() Sample Data:       [ 524 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 1674 taxa by 13 taxonomic ranks ]
phylo_eDNA_decontam_filtered #final data
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 1026 taxa and 505 samples ]
sample_data() Sample Data:       [ 505 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 1026 taxa by 13 taxonomic ranks ]

Set-up (functions and variables)

First, let’s stop scientific notation being presented in plots.

#| label: number-setting

options(scipen=5)

Let’s set-up some functions we’ll use later on to extract pieces of information from our data. Note: these functions only work currently for the format of IDs in this data set. They made need altering for other data sets.

#| label: qc-functions

# Extract fieldID when adding TRUE or FALSE for replicate status
extract_middle <- function(x) {
  middle <- gsub("^[^-]+-([A-Za-z]{2}\\d{2}-\\d{2}).*_(18S|CO1)$", "\\1", x)
  return(middle)
}

# Extract site when adding TRUE or FALSE for replicate status
extract_site <- function(x) {
  # Extract the part after the first '-' and before the second '-' or '_' and remove anything after
  middle <- gsub("^[^-]+-([^-]+)-.*_(18S|CO1)$", "\\1", x)
  return(middle)
}


# Extract the middle part (including fieldID and primer)
extract_middle_all <- function(x) {
  # Extract the middle part of the string
  middle <- gsub("^[^-]+-(.+)$", "\\1", x)
  
  # Remove the term 'rep' and any following number
  middle <- gsub("rep\\d*", "", middle, ignore.case = TRUE)
  
  # Return the modified middle part
  return(middle)
}

# Modify the extract_middle function to extract the fieldID part for CO1 only groups (run 3)
extract_middle_CO1 <- function(x) {
  middle <- gsub("^[^-]+-([A-Za-z]{2}\\d{2}-\\d{2}).*_CO1$", "\\1", x)
  return(middle)
}

We need to set some variables for plots later.

#| label: qc-plot-variables

site_order <- c("Scourie", 
                "Rispond", 
                "Skerray", 
                "Murkle Bay", 
                "Portskerra", 
                "Borwick, Yesnaby", 
                "Sannick", 
                "Wick", #Scotland
                "Aberystwyth", 
                "Neyland", 
                "Broad Haven", 
                "Skomer Island", 
                "West Angle", 
                "Monkstone Point", 
                "Dale Jetty", 
                "Martin's Haven", #South Wales
                "Castlehead Rocks", 
                "Filey Brigg", 
                "Newton Point", 
                "Rumbling Kern", 
                "Scalby Mills", #Northumbria
                "Great Orme East", 
                "Little Orme", 
                "Menai Bridge", 
                "Porth Oer", 
                "Porth Swtan", 
                "Rhosneigr", #North Wales
                "Lizard Point", 
                "Looe", 
                "Sennen Cove", 
                "St Ives", 
                "Trevone") #Cornwall

control_order <- c("field-control", 
                   "lab-extraction-control", 
                   "lab-negative-control", 
                   "lab-positive-control", 
                   "sample", 
                   "run-replicate", 
                   "failed-repeat", 
                   "plate-replicate")

control_order_tidy <- c("Field control", 
                        "Lab extraction control", 
                        "Lab negative control", 
                        "Lab positive control", 
                        "Sample", 
                        "Run replicate", 
                        "Failed repeat", 
                        "Plate replicate")

Explore read depths

Table summary

Let’s summarize the number of reads before and after decontamination and filtering.

We calculated the pre-filtered data above, so now let’s calculate the pre decontamination and post filtered data, then compare them.

Pre-decontamination first.

#| label: read-depth-summary-before-decontam

# Number of reads per sample (after decontamination and filtering)
sample_depths_predecontam <- microbiome::readcount(phylo_eDNA_predecontam) %>% 
  as.data.frame() %>%
  tibble::rownames_to_column(var = "fullID")

colnames(sample_depths_predecontam) <- c("fullID", "reads_predecontam")

# Calculate the total ASVs by counting the number of rows 
num_asvs_vec_predecontam <- c(nrow(phyloseq::otu_table(phylo_eDNA_predecontam)))  
names(num_asvs_vec_predecontam)[1] <- "no.taxa" 
num_asvs_vec_predecontam
no.taxa 
   1725 
# Total number asvs per sample 
asv_sum_predecontam <- as.data.frame(colSums(phyloseq::otu_table(phylo_eDNA_predecontam)!=0))  

#Extract sample meta data as a separate R object 
abundance_metadf_predecontam <- phyloseq::sample_data(phylo_eDNA_predecontam) 

#Check if vector of sample_depths & asv_sum has the same order as our metadata rows
identical(sample_depths_predecontam$fullID,row.names(abundance_metadf_predecontam))
[1] TRUE
identical(row.names(asv_sum_predecontam),row.names(abundance_metadf_predecontam))  
[1] TRUE
#Add sample depths and number of ASVs to metadata data frame 
abundance_metadf_predecontam[,"depth"] <- sample_depths_predecontam$reads_predecontam
abundance_metadf_predecontam[,"ASVs"] <- asv_sum_predecontam

Post-filtered.

#| label: read-depth-summary-after-filter

# Number of reads per sample (after decontamination and filtering)
sample_depths_decontam_filter <- microbiome::readcount(phylo_eDNA_decontam_filtered) %>% 
  as.data.frame() %>%
  tibble::rownames_to_column(var = "fullID")

colnames(sample_depths_decontam_filter) <- c("fullID", "reads_postfilter")

# Calculate the total ASVs by counting the number of rows 
num_asvs_vec_filter <- c(nrow(phyloseq::otu_table(phylo_eDNA_decontam_filtered)))  
names(num_asvs_vec_filter)[1] <- "no.taxa" 
num_asvs_vec_filter
no.taxa 
   1026 
# Total number asvs per sample 
asv_sum_filter <- as.data.frame(colSums(phyloseq::otu_table(phylo_eDNA_decontam_filtered)!=0))  

#Extract sample meta data as a separate R object 
abundance_metadf_filter <- phyloseq::sample_data(phylo_eDNA_decontam_filtered) 

#Check if vector of sample_depths & asv_sum has the same order as our metadata rows
identical(sample_depths_decontam_filter$fullID,row.names(abundance_metadf_filter)) 
[1] TRUE
identical(row.names(asv_sum_filter),row.names(abundance_metadf_filter))  
[1] TRUE
#Add sample depths and number of ASVs to metadata data frame 
abundance_metadf_filter[,"depth"] <- sample_depths_decontam_filter$reads_postfilter
abundance_metadf_filter[,"ASVs"] <- asv_sum_filter

Join depth information into one data set.

#| label: read-depth-summary-all

# Reads before and after decontamination together
all_depths <- left_join(sample_depths_decontam, 
                        sample_depths_decontam_filter, 
                        by = "fullID")

all_depths <- left_join(sample_depths_predecontam, 
                        all_depths, 
                        by = "fullID")

#add difference between start and end
all_depths$reads_removed <- all_depths$reads_prefilter - all_depths$reads_postfilter 

tail(all_depths)
                  fullID reads_predecontam reads_prefilter reads_postfilter
650 PHD3-SCH04-09rep_CO1             67248           66980             4956
651 PHD3-SCH07-02rep_CO1             75436           75403            54742
652  PHD3-SW01-06rep_CO1             49183           49183             9203
653  PHD3-SW03-08rep_CO1             32311           32311              498
654  PHD3-SW05-01rep_CO1             20202           20020              165
655  PHD3-SW07-03rep_CO1             37441           37441             1455
    reads_removed
650         62024
651         20661
652         39980
653         31813
654         19855
655         35986

Let’s create some figures to visualize read depths before and after filtering. We’ll need to do some data wrangling for plotting.

Histograms

Pre-decontamination.

#| message: false
#| label: reads-summarize-before-decontam

sample_depths_predecontam$primer <- sapply(strsplit(sample_depths_predecontam$fullID, "_", fixed=TRUE), tail, 1) # Add primer variable

#check which samples have no reads and remove
sample_depths_predecontam_zero <- sample_depths_predecontam %>% subset(sample_depths_predecontam == 0)
sample_depths_predecontam_nozero <- anti_join(sample_depths_predecontam, sample_depths_predecontam_zero)

#get means
mu_primer <- sample_depths_predecontam_nozero %>% 
  dplyr::group_by(primer) %>% 
  dplyr::summarise(mean = mean(reads_predecontam),
                   SE = sd(reads_predecontam) / sqrt(n()))

print(mu_primer)
# A tibble: 2 × 3
  primer   mean    SE
  <chr>   <dbl> <dbl>
1 18S    53284. 3312.
2 CO1    26251. 1417.
#| label: reads-histo-before-decontam

reads_histo_predecontam <- ggplot(sample_depths_predecontam_nozero, aes(x=reads_predecontam, fill = primer, colour = primer)) + 
  geom_histogram(bins = 60, alpha = 0.9, position = "dodge") + 
  geom_vline(data=mu_primer, aes(xintercept=mean, color=primer),
             linetype="dashed")+
  facet_wrap(~primer, scale = 'free_x') +
  scale_color_manual(values=c("grey50","grey50"))+
  scale_fill_manual(values=c("#96E6B3","#E5A361"))+
  xlab("Sample depth (pre-decontamination)") + ylab("Sample frequency") +
  labs(fill = "Primer", colour = "Primer")+
  #xlim(0, 200000) + #can limited extreme values to view pattern better
  theme_classic()

reads_histo_predecontam

Pre-filtering.

sample_depths_decontam$primer <- sapply(strsplit(sample_depths_decontam$fullID, "_", fixed=TRUE), tail, 1) # Add primer variable

#check which samples have no reads and remove
sample_depths_decontam_zero <- sample_depths_decontam %>% subset(sample_depths_decontam == 0)
sample_depths_decontam_nozero <- anti_join(sample_depths_decontam, sample_depths_decontam_zero)

#get means
mu_primer <- sample_depths_decontam_nozero %>% 
  dplyr::group_by(primer) %>% 
  dplyr::summarise(mean = mean(reads_prefilter),
                   SE = sd(reads_prefilter) / sqrt(n()))

print(mu_primer)
# A tibble: 2 × 3
  primer   mean    SE
  <chr>   <dbl> <dbl>
1 18S    51513. 3217.
2 CO1    26364. 1489.
#| label: reads-histo-before-filter

reads_histo <- ggplot(sample_depths_decontam_nozero, aes(x=reads_prefilter, fill = primer, colour = primer)) + 
  geom_histogram(bins = 60, alpha = 0.9, position = "dodge") + 
  geom_vline(data=mu_primer, aes(xintercept=mean, color=primer),
             linetype="dashed")+
  facet_wrap(~primer, scale = 'free_x') +
  scale_color_manual(values=c("grey50","grey50"))+
  scale_fill_manual(values=c("#96E6B3","#E5A361"))+
  xlab("Sample depth (post-decontamination)") + ylab("Sample frequency") +
  labs(fill = "Primer", colour = "Primer")+
  #xlim(0, 200000) + #can limited extreme values to view pattern better
  theme_classic()

reads_histo

Post-filtering.

sample_depths_decontam_filter$primer <- sapply(strsplit(sample_depths_decontam_filter$fullID, "_", fixed=TRUE), tail, 1) # Add primer variable

#check which samples have no reads and remove
sample_depths_decontam_filter_zero <- sample_depths_decontam_filter %>% subset(sample_depths_decontam_filter == 0)
sample_depths_decontam_filter_nozero <- anti_join(sample_depths_decontam_filter, sample_depths_decontam_filter_zero)

#get means
mu_primer_filter <- sample_depths_decontam_filter_nozero %>% 
  dplyr::group_by(primer) %>% 
  dplyr::summarise(mean = mean(reads_postfilter),
                   SE = sd(reads_postfilter) / sqrt(n()))

print(mu_primer_filter)
# A tibble: 2 × 3
  primer   mean    SE
  <chr>   <dbl> <dbl>
1 18S    26594. 2171.
2 CO1    10258.  938.
#| label: reads-histo-after-filter

reads_histo_filter <- ggplot(sample_depths_decontam_filter_nozero, aes(x=reads_postfilter, fill = primer, colour = primer)) + 
  geom_histogram(bins = 60, alpha = 0.9, position = "dodge") + 
  geom_vline(data=mu_primer_filter, aes(xintercept=mean, color=primer),
             linetype="dashed")+
  facet_wrap(~primer, scale = 'free_x') +
  scale_color_manual(values=c("grey50","grey50"))+
  scale_fill_manual(values=c("#96E6B3","#E5A361"))+
  xlab("Sample depth (post-filtering)") + ylab("Sample frequency") +
  labs(fill = "Primer", colour = "Primer")+
  #xlim(0, 200000) + #can limited extreme values to view pattern better
  theme_classic()

reads_histo_filter

Join them together to export.

#| label: join-reads-histo

reads_histo_together <- cowplot::plot_grid(reads_histo_predecontam, reads_histo, reads_histo_filter, labels = c("a", "b", "c"), ncol = 1)

reads_histo_together

#save
ggsave(reads_histo_together, filename = "Figures/sample_depth_histogram_together.png", height = 300, width = 220, dpi = 300, units = "mm")

Reads by site

Let’s look at reads over sites in boxplots.

Pre-decontamination.

#| label: reads-boxplot-before-decontam-site

reads_boxplot_sites_predecontam <- ggplot2::ggplot(abundance_metadf_predecontam, aes(y=depth, x=verbatimLocality, colour = country)) +
  ggplot2::geom_boxplot() +
  scale_x_discrete(limits = site_order)+
  scale_colour_manual(values = c("Scotland" = "darkseagreen3",
                                 "North Wales" = "lightpink3",
                                 "Northeast England" = "yellow3",
                                 "South Wales" = "lightblue",
                                 "Southwest England" = "purple3")) +
  xlab("Site")+ ylab("Read depth") +
  labs(colour = "Region") +
  facet_wrap(~primer) +
  theme_classic() +
  theme(axis.text.x = element_text(angle = 90, vjust = 0.5, hjust=1))

reads_boxplot_sites_predecontam

Pre-filtering.

#| label: reads-boxplot-before-filter-site

reads_boxplot_sites <- ggplot2::ggplot(abundance_metadf, aes(y=depth, x=verbatimLocality, colour = country)) +
  ggplot2::geom_boxplot() +
  scale_x_discrete(limits = site_order)+
  scale_colour_manual(values = c("Scotland" = "darkseagreen3",
                                 "North Wales" = "lightpink3",
                                 "Northeast England" = "yellow3",
                                 "South Wales" = "lightblue",
                                 "Southwest England" = "purple3")) +
  xlab("Site")+ ylab("Read depth") +
  labs(colour = "Region") +
  facet_wrap(~primer) +
  theme_classic() +
  theme(axis.text.x = element_text(angle = 90, vjust = 0.5, hjust=1))

reads_boxplot_sites

Post-filtering.

#| label: reads-boxplot-after-filter-site

reads_boxplot_sites_filter <- ggplot2::ggplot(abundance_metadf_filter, aes(y=depth, x=verbatimLocality, colour = country)) +
  ggplot2::geom_boxplot() +
  scale_x_discrete(limits = site_order)+
  scale_colour_manual(values = c("Scotland" = "darkseagreen3",
                                 "North Wales" = "lightpink3",
                                 "Northeast England" = "yellow3",
                                 "South Wales" = "lightblue",
                                 "Southwest England" = "purple3")) +
  xlab("Site")+ ylab("Read depth (post filtering)") +
  labs(colour = "Region") +
  facet_wrap(~primer) +
  theme_classic() +
  theme(axis.text.x = element_text(angle = 90, vjust = 0.5, hjust=1))

reads_boxplot_sites_filter

Join them together to export.

#| label: join-boxplot-reads-site

reads_boxplot_sites_together <- cowplot::plot_grid(reads_boxplot_sites_predecontam, reads_boxplot_sites, reads_boxplot_sites_filter, labels = c("a", "b", "c"), ncol = 1) 

reads_boxplot_sites_together  

#save 
ggsave(reads_boxplot_sites_together, filename = "Figures/reads_boxplot_sites_together.png", height = 400, width = 250, dpi = 300, units = "mm")

Reads by sample type

Let’s tidy the names of our sample types.

#| label: tidy-sample-type-names

abundance_metadf_predecontam <- abundance_metadf_predecontam %>%
  data.frame() %>% 
  dplyr::mutate(tidy_type_name = case_when(
    sampleType == "field-control" ~ "Field control",
    sampleType == "lab-extraction-control" ~ "Lab extraction control",
    sampleType == "lab-negative-control" ~ "Lab negative control",
    sampleType == "lab-positive-control" ~ "Lab positive control",
    sampleType == "sample" ~ "Sample",
    sampleType == "run-replicate" ~ "Run replicate",
    sampleType == "failed-repeat" ~ "Failed repeat",
    sampleType == "plate-replicate" ~ "Plate replicate",
    TRUE ~ as.character(sampleType) # This keeps any unmatched sampleType values
  ))

abundance_metadf <- abundance_metadf %>%
  data.frame() %>% 
  dplyr::mutate(tidy_type_name = case_when(
    sampleType == "field-control" ~ "Field control",
    sampleType == "lab-extraction-control" ~ "Lab extraction control",
    sampleType == "lab-negative-control" ~ "Lab negative control",
    sampleType == "lab-positive-control" ~ "Lab positive control",
    sampleType == "sample" ~ "Sample",
    sampleType == "run-replicate" ~ "Run replicate",
    sampleType == "failed-repeat" ~ "Failed repeat",
    sampleType == "plate-replicate" ~ "Plate replicate",
    TRUE ~ as.character(sampleType) # This keeps any unmatched sampleType values
  ))

abundance_metadf_filter <- abundance_metadf_filter %>%
  data.frame() %>% 
  dplyr::mutate(tidy_type_name = case_when(
    sampleType == "field-control" ~ "Field control",
    sampleType == "lab-extraction-control" ~ "Lab extraction control",
    sampleType == "lab-negative-control" ~ "Lab negative control",
    sampleType == "lab-positive-control" ~ "Lab positive control",
    sampleType == "sample" ~ "Sample",
    sampleType == "run-replicate" ~ "Run replicate",
    sampleType == "failed-repeat" ~ "Failed repeat",
    sampleType == "plate-replicate" ~ "Plate replicate",
    TRUE ~ as.character(sampleType) # This keeps any unmatched sampleType values
  ))

Before decontamination.

#| label: reads-boxplot-sample-types-predecontam 

reads_boxplot_sample_types_predecontam <- ggplot(abundance_metadf_predecontam, aes(x=tidy_type_name, y=depth, color=tidy_type_name)) + 
  geom_boxplot() + theme_bw() +
  geom_jitter(alpha=0.2) +
  scale_color_manual(values = c("Field control" = "brown", 
                                "Lab extraction control" = "red4",
                                "Lab negative control" = "red", 
                                "Lab positive control" = "green3",
                                "Sample" ="cyan4", 
                                "Run replicate" = "lightblue3", 
                                "Failed repeat" = "blue4", 
                                "Plate replicate" = "lightblue4"), na.value = "darkgrey") +
  #facet_wrap(~primer, scales = "free_y") +
  scale_x_discrete(limits = control_order_tidy)+
  xlab("Sample type") + ylab("Read depth") +
  labs(colour = "Sample type") +
  theme_classic() +
  theme(axis.text.x = element_text(angle=45, h=1),
        legend.position = "none")

reads_boxplot_sample_types_predecontam

Pre-filtering. We shouldn’t see negative or positive controls here anymore.

#| label: reads-boxplot-sample-types-prefilter

reads_boxplot_sample_types <- ggplot(abundance_metadf, aes(x=tidy_type_name, y=depth, color=tidy_type_name)) + 
  geom_boxplot() + theme_bw() +
  geom_jitter(alpha=0.2) +
  scale_color_manual(values = c("Field control" = "brown", 
                                "Lab extraction control" = "red4",
                                "Lab negative control" = "red", 
                                "Lab positive control" = "green3",
                                "Sample" ="cyan4", 
                                "Run replicate" = "lightblue3", 
                                "Failed repeat" = "blue4", 
                                "Plate replicate" = "lightblue4"), na.value = "darkgrey") +
  #facet_wrap(~primer, scales = "free_y") +
  scale_x_discrete(limits = control_order_tidy)+
  xlab("Sample type") + ylab("Read depth") +
  labs(colour = "Sample type") +
  theme_classic() +
  theme(axis.text.x = element_text(angle=45, h=1),
        legend.position = "none")

reads_boxplot_sample_types

Explore ASVs (or taxa at this point)

Pre-decontamination.

#| label: asv-boxplot-sample-types-predecontam 

ASVs_boxplot_sample_types_predecontam <- ggplot(abundance_metadf_predecontam, aes(x=tidy_type_name, y=ASVs, color=tidy_type_name)) +
  geom_boxplot() + theme_classic() +
  geom_jitter(alpha=0.2) +
  scale_color_manual(values = c("Field control" = "brown", 
                                "Lab extraction control" = "red4",
                                "Lab negative control" = "red", 
                                "Lab positive control" = "green3",
                                "Sample" ="cyan4", 
                                "Run replicate" = "lightblue3", 
                                "Failed repeat" = "blue4", 
                                "Plate replicate" = "lightblue4"), na.value = "darkgrey") +
  #facet_wrap(~primer, scales = "free_y") +
  scale_x_discrete(limits = control_order_tidy) +
  labs(x = "Sample type", y = "Number of taxa") +
  theme(axis.text.x = element_text(angle=45, h=1), legend.position = "none")

ASVs_boxplot_sample_types_predecontam

Pre-filtering

#| label: asv-boxplot-sample-types-prefilter 

ASVs_boxplot_sample_types_decontam <- ggplot(abundance_metadf, aes(x=tidy_type_name, y=ASVs, color=tidy_type_name)) +
  geom_boxplot() + theme_classic() +
  geom_jitter(alpha=0.2) +
  scale_color_manual(values = c("Field control" = "brown", 
                                "Lab extraction control" = "red4",
                                "Lab negative control" = "red", 
                                "Lab positive control" = "green3",
                                "Sample" ="cyan4", 
                                "Run replicate" = "lightblue3", 
                                "Failed repeat" = "blue4", 
                                "Plate replicate" = "lightblue4"), na.value = "darkgrey") +
  #facet_wrap(~primer, scales = "free_y") +
  scale_x_discrete(limits = control_order_tidy) +
  labs(x= "Sample type", y = "Number of taxa")+
  theme(axis.text.x = element_text(angle=45, h=1), legend.position = "none")

ASVs_boxplot_sample_types_decontam

Let’s make a plot to show the raw reads and ASVs.

#| label: asv-reads-boxplot 

ASVs_reads_sampletype <- cowplot::plot_grid(ASVs_boxplot_sample_types_predecontam, reads_boxplot_sample_types_predecontam, labels = c("a", "b", ncol = 2), rel_widths = c(1,1.1))

ASVs_reads_sampletype

ggsave(filename = "Figures/ASVs_reads_sampletype.png", plot = ASVs_reads_sampletype,
       device = "png", dpi = 300, units = "mm", height = 140, width = 270)

We can also look at number of taxa in a scatter.

#| message: false
#| label: asvs-scatter-sample-types-predecontam 

ASV_reads_scatter_predecontam <- ggplot(abundance_metadf_predecontam, aes(x=depth, y=ASVs, color = tidy_type_name)) +
  geom_point() + 
  scale_y_log10() + scale_x_log10() +
  scale_color_manual(values = c("Field control" = "brown", 
                                "Lab extraction control" = "red4",
                                "Lab negative control" = "red", 
                                "Lab positive control" = "green3",
                                "Sample" ="cyan4", 
                                "Run replicate" = "lightblue3", 
                                "Failed repeat" = "blue4", 
                                "Plate replicate" = "lightblue4"), na.value = "darkgrey") +
  labs(color = "Sample type", x = "Depth", y = "Taxa detected per sample") +
  theme_classic()

ASV_reads_scatter_predecontam

Comparing replicates

We have replication in different forms in our data. We have field replicates and technical replicates (between and within runs). We need to check how similar they are.

Let’s define replicates first.

#| label: filter-explore-all-replicates

# Subset replicates and their counter parts
phylo_replicates_pairs = subset_samples(phylo_eDNA_decontam_filtered, 
                                        pairedRepLogical == TRUE) 

#further subs
phylo_replicates = subset_samples(phylo_eDNA_decontam_filtered, 
                                  sampleType == "run-replicate" | sampleType == "plate-replicate") 

phylo_run_replicates = subset_samples(phylo_eDNA_decontam_filtered, 
                                      sampleType == "run-replicate")

phylo_sample_replicates = subset_samples(phylo_eDNA_decontam_filtered,
                                         sampleType == "plate-replicate")  

replicate_names <- unique(sample_data(phylo_replicates)$fullID)
head(replicate_names)
[1] "PHD1-SCH01-04rep_18S" "PHD1-SCH01-04rep_CO1" "PHD1-SCH03-05rep_18S"
[4] "PHD1-SCH04-09rep_18S" "PHD1-SCH04-09rep_CO1" "PHD1-SCH07-02rep_18S"
##Clean out taxa/ASV columns that are no longer present
phylo_replicates <- prune_taxa(taxa_sums(phylo_replicates) > 0, phylo_replicates) 

#How abundant are the ASVs in the controls? 
plot(sort(taxa_sums(phylo_replicates), TRUE), type="h")

#What's in them?
plot_bar(phylo_replicates, "fullID", fill = "phylum")

Between runs

Let’s order our samples for plotting later.

#| label: define-replicates-between-runs

# Sort lists of replicates
sample_order_run1v2 <- c(
  "PHD1-SCH01-04rep_18S",
  "PHD2-SCH01-04rep_18S",
  "PHD1-SCH01-04rep_CO1",
  "PHD2-SCH01-04rep_CO1",
  "PHD1-SCH03-05rep_18S",
  "PHD2-SCH03-05rep_18S",
  "PHD1-SCH04-09rep_18S",
  "PHD2-SCH04-09rep_18S",
  "PHD1-SCH04-09rep_CO1",
  "PHD2-SCH04-09rep_CO1",
  "PHD1-SCH07-02rep_18S",
  "PHD2-SCH07-02rep_18S",
  "PHD1-SCH07-02rep_CO1",
  "PHD2-SCH07-02rep_CO1",
  "PHD1-SW01-06rep_18S",
  "PHD2-SW01-06rep_18S",
  "PHD1-SW01-06rep_CO1",
  "PHD2-SW01-06rep_CO1",
  "PHD1-SW03-08rep_18S",
  "PHD2-SW03-08rep_18S",
  "PHD1-SW03-08rep_CO1",
  "PHD2-SW03-08rep_CO1",
  "PHD1-SW05-01rep_18S"
  #"PHD2-SW05-01rep_18S",
  #"PHD1-SW05-01rep_CO1",
  #"PHD2-SW05-01rep_CO1",
  #"PHD1-SW07-03rep_18S",
  #"PHD2-SW07-03rep_18S",
  #"PHD1-SW07-03rep_CO1",
  #"PHD2-SW07-03rep_CO1"
)

sample_order_run1v3 <- c(
  "PHD1-SCH01-04rep_CO1",
  "PHD3-SCH01-04rep_CO1",
  "PHD1-SCH04-09rep_CO1",
  "PHD3-SCH04-09rep_CO1",
  "PHD1-SCH07-02rep_CO1",
  "PHD3-SCH07-02rep_CO1",
  "PHD1-SW01-06rep_CO1",
  "PHD3-SW01-06rep_CO1",
  "PHD1-SW03-08rep_CO1",
  "PHD3-SW03-08rep_CO1",
  "PHD1-SW05-01rep_CO1",
  "PHD3-SW05-01rep_CO1",
  "PHD1-SW07-03rep_CO1",
  "PHD3-SW07-03rep_CO1"
)

sample_order_run2v3 <- c(
  "PHD2-CN01-01_CO1",
  "PHD3-CN01-01rep_CO1",
  "PHD2-CN01-02_CO1",
  "PHD3-CN01-02rep_CO1",
  "PHD2-CN01-03_CO1",
  "PHD3-CN01-03rep_CO1",
  "PHD2-CN01-04_CO1",
  "PHD3-CN01-04rep_CO1",
  "PHD2-CN01-05_CO1",
  "PHD3-CN01-05rep_CO1",
  "PHD2-CN01-06_CO1",
  "PHD3-CN01-06rep_CO1",
  "PHD2-CN01-07_CO1",
  "PHD3-CN01-07rep_CO1",
  "PHD2-CN01-08_CO1",
  "PHD3-CN01-08rep_CO1"
)

Turning data into compositional form for plotting.

#| label: rel-abundance-replicates

#Transform abundance table to a relative abundance (compositional) table
pseq_relabund <- microbiome::transform(phylo_replicates_pairs, "compositional")

#Phylum phyloseq
phylum_pseq <- microbiome::aggregate_rare(pseq_relabund, "phylum",
                                          detection = 0.01, prevalence = 10/100)

Average read depths over the difference runs.

#| label: read_depth-run-replicates
#| warning: false

# Compute read depth (total reads per sample)
read_depth_reps <- sample_sums(phylo_replicates)  # Sum of reads per sample

# Extract sample metadata
metadata_reps <- sample_data(phylo_replicates) %>% as.data.frame()

# Ensure "projectID" is numeric (assuming it represents the year)
metadata_reps$projectID <- as.factor(metadata_reps$projectID) 
metadata_reps$fieldID <- as.factor(metadata_reps$fieldID) 

# Merge read depth into metadata
metadata_reps$ReadDepth <- read_depth_reps

# Plot the average read depth over time
ggplot(metadata_reps, aes(x = projectID, y = ReadDepth, colour = projectID)) +
  geom_boxplot()+
  labs(x = "Year",
       y = "Average Read Depth") +
  theme_minimal()

#depth sample label order
depth_label_order <- c(
  "PHD1-SCH01-04rep",
  "PHD2-SCH01-04rep",
  "PHD3-SCH01-04rep",
  "PHD1-SCH03-05rep",
  "PHD2-SCH03-05rep",
  "PHD1-SCH04-09rep",
  "PHD2-SCH04-09rep",
  "PHD3-SCH04-09rep",
  "PHD1-SCH07-02rep",
  "PHD2-SCH07-02rep",
  "PHD3-SCH07-02rep",
  "PHD1-SW01-06rep",
  "PHD2-SW01-06rep",
  "PHD3-SW01-06rep",
  "PHD1-SW03-08rep",
  "PHD2-SW03-08rep",
  "PHD3-SW03-08rep",
  "PHD1-SW05-01rep",
  "PHD2-SW05-01rep",
  "PHD3-SW05-01rep",
  "PHD1-SW07-03rep",
  "PHD2-SW07-03rep",
  "PHD3-SW07-03rep",
  "PHD3-CN01-01rep",
  "PHD3-CN01-02rep",
  "PHD3-CN01-03rep",
  "PHD3-CN01-04rep",
  "PHD3-CN01-05rep",
  "PHD3-CN01-06rep",
  "PHD3-CN01-07rep",
  "PHD3-CN01-08rep"
)

# Plot the average read depth over time
ggplot(metadata_reps, aes(x = fieldID, y = ReadDepth, fill = projectID)) +
  geom_bar(stat = "identity") +
  labs(x = "Sample",
       y = "Average Read Depth") +
  theme_minimal()  + 
  theme(axis.text.x = element_text(angle = 45, hjust = 1)) + # Slant x-axis labels at 45 degrees
  scale_x_discrete(limits = c(depth_label_order))

Comparison taxa plot for run 1 vs run 2.

#| warning: false
#| label: composition-run-replicates-1vs2

run_replicates_taxa_plot_1v2 <- microbiome::plot_composition(phylum_pseq) + 
  xlab("Sample") + ylab("Relative abundance")+
  scale_x_discrete(limits = c(sample_order_run1v2))

run_replicates_taxa_plot_1v2

ggsave(filename = "Figures/run_replicates_taxa_plot_1v2_curated_98.png", plot = run_replicates_taxa_plot_1v2,
       device = "png", dpi = 300, units = "mm", height = 200, width = 350)

Dissimilarity for run 1 vs run 2.

#| warning: false
#| label: dissim-run-replicates-1vs2

#Jaccard dissimilarity (based on P/A) - high value = most different
replicates_run1v2_phylo <- phylo_eDNA_decontam_filtered %>% 
  subset_samples(fullID %in% sample_order_run1v2) # subset phylo

run_replicates_dis_jaccard_1v2 <- as.matrix(distance(replicates_run1v2_phylo, "jaccard", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(run_replicates_dis_jaccard_1v2)
longData<-longData[longData$value!=0,]

# Add TRUE or FALSE variable for replicates
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle_all) == sapply(longData$Var2, extract_middle_all), TRUE, FALSE)

# Extract the last section of the sample names
longData$primerVar1 <- sub(".*_(18S|CO1)$", "\\1", longData$Var1)
longData$primerVar2 <- sub(".*_(18S|CO1)$", "\\1", longData$Var2)
longData_sameprimer <- filter(longData, primerVar1 == primerVar2)

#Individual primer datasets
longData18S <- subset(longData_sameprimer, primerVar1 == "18S")
longDataCO1 <- subset(longData_sameprimer, primerVar1 == "CO1")

#plot matrix (CO1)
dis_CO1_matrix_run1v2 <- ggplot(longDataCO1, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longDataCO1, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "coral3", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (Run 1 vs Run 2)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_CO1_matrix_run1v2

ggsave(filename = "Figures/dis_CO1_matrix_run1v2_curated_98.png", plot = dis_CO1_matrix_run1v2 ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

#plot matrix (18S)
dis_18S_matrix_run1v2 <- ggplot(longData18S, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longData18S, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "green4", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (Run 1 vs Run 2)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_18S_matrix_run1v2

ggsave(filename = "Figures/dis_18S_matrix_run1vs_curated_98.png", plot = dis_18S_matrix_run1v2 ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

Same again for run 1 vs run 3.

#| label: composition-run-replicates-1vs3

# Comparison taxa plot
run_replicates_taxa_plot_1v3 <- microbiome::plot_composition(phylum_pseq) + 
  xlab("Sample") + ylab("Relative abundance")+
  scale_x_discrete(limits = c(sample_order_run1v3))

run_replicates_taxa_plot_1v3

ggsave(filename = "Figures/run_replicates_taxa_plot_1v3_curated_98.png", plot = run_replicates_taxa_plot_1v3,
       device = "png", dpi = 300, units = "mm", height = 200, width = 350)
#| label: dissim-run-replicates-1vs3

# Dissimilarity 
#Jaccard dissimilarity (based on P/A) - high value = most different
replicates_run1v3_phylo <- phylo_eDNA_decontam_filtered %>% 
  subset_samples(fullID %in% sample_order_run1v3) # subset phylo

run_replicates_dis_jaccard_1v3 <- as.matrix(distance(replicates_run1v3_phylo, "jaccard", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(run_replicates_dis_jaccard_1v3)
longData<-longData[longData$value!=0,]

# Add TRUE or FALSE variable for replicates (same as previous)
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle_CO1) == sapply(longData$Var2, extract_middle_CO1), TRUE, FALSE)

#plot matrix (CO1)
dis_CO1_matrix_run1v3 <- ggplot(longData, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longData, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "coral3", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (Run 1 vs Run 3)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_CO1_matrix_run1v3

ggsave(filename = "Figures/dis_CO1_matrix_run1v3_curated_98.png", plot = dis_CO1_matrix_run1v3 ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

For run 2 and run 3.

#| label: composition-run-replicates-2vs3

# Comparison taxa plot
run_replicates_taxa_plot_2v3 <- microbiome::plot_composition(phylum_pseq) + 
  xlab("Sample") + ylab("Relative abundance")+
  scale_x_discrete(limits = c(sample_order_run2v3))

run_replicates_taxa_plot_2v3

ggsave(filename = "Figures/run_replicates_taxa_plot_2v3_curated_98.png", plot = run_replicates_taxa_plot_2v3,
       device = "png", dpi = 300, units = "mm", height = 200, width = 450)
#| label: dissim-run-replicates-2vs3

#Dissimilarity 
#Jaccard dissimilarity (based on P/A) - high value = most different
replicates_run2v3_phylo <- phylo_eDNA_decontam_filtered %>% subset_samples(fullID %in% sample_order_run2v3) # subset phylo
run_replicates_dis_jaccard_2v3 <- as.matrix(distance(replicates_run2v3_phylo, "jaccard", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(run_replicates_dis_jaccard_2v3)
longData<-longData[longData$value!=0,]

# Add TRUE or FALSE variable for replicates
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle_CO1) == sapply(longData$Var2, extract_middle_CO1), TRUE, FALSE)

#plot matrix (CO1)
dis_CO1_matrix_run2v3 <- ggplot(longData, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longData, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "coral3", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (Run 2 vs Run 3)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_CO1_matrix_run2v3

ggsave(filename = "Figures/dis_CO1_matrix_run2v3_curated_98.png", plot = dis_CO1_matrix_run2v3 ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

Within runs (by site)

We first set the order our our samples within each region.

#| label: define-replicates-regions

SCH_reps <- c(
  "PHD1-SCH01-04_CO1",
  "PHD1-SCH01-04rep_CO1",
  "PHD1-SCH04-09_CO1",
  "PHD1-SCH04-09rep_CO1",
  "PHD1-SCH07-02_CO1",
  "PHD1-SCH07-02rep_CO1",
  "PHD1-SCH01-04_18S",
  "PHD1-SCH01-04rep_18S",
  "PHD1-SCH03-05_18S",
  "PHD1-SCH03-05rep_18S",
  "PHD1-SCH04-09_18S",
  "PHD1-SCH04-09rep_18S",
  "PHD1-SCH07-02_18S",
  "PHD1-SCH07-02rep_18S"
)

SW_reps <- c(
  "PHD1-SW01-06_CO1",
  "PHD1-SW01-06rep_CO1",
  "PHD1-SW03-08_CO1",
  "PHD1-SW03-08rep_CO1",
  "PHD1-SW05-01_CO1",
  "PHD1-SW05-01rep_CO1",
  "PHD1-SW05-02_CO1",
  "PHD1-SW05-02rep_CO1",
  "PHD1-SW05-03_CO1",
  "PHD1-SW05-03rep_CO1",
  "PHD1-SW07-03_CO1",
  "PHD1-SW07-03rep_CO1",
  "PHD1-SW01-06_18S",
  "PHD1-SW01-06rep_18S",
  "PHD1-SW03-08_18S",
  "PHD1-SW03-08rep_18S",
  "PHD1-SW05-01_18S",
  "PHD1-SW05-01rep_18S",
  "PHD1-SW05-02_18S",
  "PHD1-SW07-03_18S",
  "PHD1-SW07-03rep_18S"
)

NW_reps <- c(
  "PHD2-NW01-02_CO1",
  "PHD2-NW01-02rep_CO1", 
  "PHD2-NW03-08_CO1",
  "PHD2-NW03-08rep_CO1",
  "PHD2-NW06-02_CO1",
  "PHD2-NW06-02rep_CO1",
  "PHD2-NW01-02_18S",
  "PHD2-NW01-02rep_18S", 
  "PHD2-NW03-08_18S",
  "PHD2-NW03-08rep_18S",
  "PHD2-NW06-02_18S",
  "PHD2-NW06-02rep_18S"
  )

CN_reps <- c(
  "PHD2-CN02-09_CO1",
  "PHD2-CN02-09rep_CO1",
  "PHD2-CN04-05_CO1",
  "PHD2-CN04-05rep_CO1",
  "PHD2-CN05-08_CO1",
  "PHD2-CN05-08rep_CO1",
  "PHD2-CN02-09_18S",
  "PHD2-CN02-09rep_18S",
  "PHD2-CN04-05_18S",
  "PHD2-CN04-05rep_18S",
  "PHD2-CN05-08_18S",
  "PHD2-CN05-08rep_18S"
  )

NE_reps <- c(  
  "PHD2-NE02-09_CO1",
  "PHD2-NE02-09rep_CO1",
  "PHD2-NE04-05_CO1",
  "PHD2-NE04-05rep_CO1",
  "PHD2-NE05-08_CO1",
  "PHD2-NE05-08rep_CO1",
  "PHD2-NE02-09_18S",
  "PHD2-NE02-09rep_18S",
  "PHD2-NE04-05_18S",
  "PHD2-NE04-05rep_18S",
  "PHD2-NE05-08_18S",
  "PHD2-NE05-08rep_18S")

South Wales

#| label: south-wales-replicate-plots

#### Comparison taxa plot
run_replicates_taxa_plot_SW <- microbiome::plot_composition(phylum_pseq) + 
  xlab("Sample") + ylab("Relative abundance")+
  scale_x_discrete(limits = c(SW_reps))

run_replicates_taxa_plot_SW 

#### Dissimilarity 

#Jaccard dissimilarity (based on P/A) - high value = most different
replicates_SW_phylo <- phylo_eDNA_decontam_filtered %>% subset_samples(fullID %in% SW_reps) # subset phylo
run_replicates_dis_jaccard_SW <- as.matrix(distance(replicates_SW_phylo, "jaccard", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(run_replicates_dis_jaccard_SW)
longData<-longData[longData$value!=0,]

# Add TRUE or FALSE variable for replicates
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle) == sapply(longData$Var2, extract_middle), TRUE, FALSE)

# Extract the last section of the sample names
longData$primerVar1 <- sub(".*_(18S|CO1)$", "\\1", longData$Var1)
longData$primerVar2 <- sub(".*_(18S|CO1)$", "\\1", longData$Var2)
longData_sameprimer <- filter(longData, primerVar1 == primerVar2)

#Individual primer datasets
longData18S <- subset(longData_sameprimer, primerVar1 == "18S")
longDataCO1 <- subset(longData_sameprimer, primerVar1 == "CO1")

#plot matrix (CO1)
dis_CO1_matrix_SW <- ggplot(longDataCO1, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longDataCO1, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "coral3", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (SW)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_CO1_matrix_SW

ggsave(filename = "Figures/PCR_replicates/dis_CO1_matrix_SW_curated_98.png", plot = dis_CO1_matrix_SW ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

#plot matrix (18S)
dis_18S_matrix_SW <- ggplot(longData18S, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longData18S, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "green4", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (SW)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_18S_matrix_SW

ggsave(filename = "Figures/PCR_replicates/dis_18S_matrix_SW_curated_98.png", plot = dis_18S_matrix_SW ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

Scotland

#| label: sch-replicate-plots

#### Comparison taxa plot 
run_replicates_taxa_plot_SCH <- microbiome::plot_composition(phylum_pseq) + 
  xlab("Sample") + ylab("Relative abundance")+
  scale_x_discrete(limits = c(SCH_reps))

run_replicates_taxa_plot_SCH

#### Dissimilarity 

#Jaccard dissimilarity (based on P/A) - high value = most different
replicates_SCH_phylo <- phylo_eDNA_decontam_filtered %>% subset_samples(fullID %in% SCH_reps) # subset phylo
run_replicates_dis_jaccard_SCH <- as.matrix(distance(replicates_SCH_phylo, "jaccard", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(run_replicates_dis_jaccard_SCH)
longData<-longData[longData$value!=0,]

# Add TRUE or FALSE variable for replicates
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle) == sapply(longData$Var2, extract_middle), TRUE, FALSE)

# Extract the last section of the sample names
longData$primerVar1 <- sub(".*_(18S|CO1)$", "\\1", longData$Var1)
longData$primerVar2 <- sub(".*_(18S|CO1)$", "\\1", longData$Var2)
longData_sameprimer <- filter(longData, primerVar1 == primerVar2)

#Individual primer datasets
longData18S <- subset(longData_sameprimer, primerVar1 == "18S")
longDataCO1 <- subset(longData_sameprimer, primerVar1 == "CO1")

#plot matrix (CO1)
dis_CO1_matrix_SCH <- ggplot(longDataCO1, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longDataCO1, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "coral3", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (SCH)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_CO1_matrix_SCH

ggsave(filename = "Figures/PCR_replicates/dis_CO1_matrix_SCH_curated_98.png", plot = dis_CO1_matrix_SCH ,
       device = "png", dpi = 300, units = "mm", height = 150, width = 250)

#plot matrix (18S)
dis_18S_matrix_SCH<- ggplot(longData18S, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longData18S, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "green4", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (SCH)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_18S_matrix_SCH

ggsave(filename = "Figures/PCR_replicates/dis_18S_matrix_SCH_curated_98.png", plot = dis_18S_matrix_SCH ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

Cornwall

#| label: CN-replicate-plots

#### Comparison taxa plot 
run_replicates_taxa_plot_CN <- microbiome::plot_composition(phylum_pseq) + 
  xlab("Sample") + ylab("Relative abundance")+
  scale_x_discrete(limits = c(CN_reps))

run_replicates_taxa_plot_CN

#### Dissimilarity 

#Jaccard dissimilarity (based on P/A) - high value = most different
replicates_CN_phylo <- phylo_eDNA_decontam_filtered %>% subset_samples(fullID %in% CN_reps) # subset phylo
run_replicates_dis_jaccard_CN <- as.matrix(distance(replicates_CN_phylo, "jaccard", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(run_replicates_dis_jaccard_CN)
longData<-longData[longData$value!=0,]

# Add TRUE or FALSE variable for replicates
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle) == sapply(longData$Var2, extract_middle), TRUE, FALSE)

# Extract the last section of the sample names
longData$primerVar1 <- sub(".*_(18S|CO1)$", "\\1", longData$Var1)
longData$primerVar2 <- sub(".*_(18S|CO1)$", "\\1", longData$Var2)
longData_sameprimer <- filter(longData, primerVar1 == primerVar2)

#Individual primer datasets
longData18S <- subset(longData_sameprimer, primerVar1 == "18S")
longDataCO1 <- subset(longData_sameprimer, primerVar1 == "CO1")

#plot matrix (CO1)
dis_CO1_matrix_CN <- ggplot(longDataCO1, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longDataCO1, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "coral3", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (CN)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_CO1_matrix_CN

ggsave(filename = "Figures/PCR_replicates/dis_CO1_matrix_CN_curated_98.png", plot = dis_CO1_matrix_CN ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

#plot matrix (18S)
dis_18S_matrix_CN <- ggplot(longData18S, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longData18S, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "green4", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (CN)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_18S_matrix_CN

ggsave(filename = "Figures/PCR_replicates/dis_18S_matrix_CN_curated_98.png", plot = dis_18S_matrix_CN ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

Northeast England

#| label: northeast-replicate-plots

#### Comparison taxa plot 
run_replicates_taxa_plot_NE <- microbiome::plot_composition(phylum_pseq) + 
  xlab("Sample") + ylab("Relative abundance")+
  scale_x_discrete(limits = c(NE_reps))

run_replicates_taxa_plot_NE

#### Dissimilarity 

#Jaccard dissimilarity (based on P/A) - high value = most different
replicates_NE_phylo <- phylo_eDNA_decontam_filtered %>% subset_samples(fullID %in% NE_reps) # subset phylo
run_replicates_dis_jaccard_NE <- as.matrix(distance(replicates_NE_phylo, "jaccard", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(run_replicates_dis_jaccard_NE)
longData<-longData[longData$value!=0,]

# Add TRUE or FALSE variable for replicates
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle) == sapply(longData$Var2, extract_middle), TRUE, FALSE)

# Extract the last section of the sample names
longData$primerVar1 <- sub(".*_(18S|CO1)$", "\\1", longData$Var1)
longData$primerVar2 <- sub(".*_(18S|CO1)$", "\\1", longData$Var2)
longData_sameprimer <- filter(longData, primerVar1 == primerVar2)

#Individual primer datasets
longData18S <- subset(longData_sameprimer, primerVar1 == "18S")
longDataCO1 <- subset(longData_sameprimer, primerVar1 == "CO1")

#plot matrix (CO1)
dis_CO1_matrix_NE <- ggplot(longDataCO1, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longDataCO1, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "coral3", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (NE)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_CO1_matrix_NE

ggsave(filename = "Figures/PCR_replicates/dis_CO1_matrix_NE_curated_98.png", plot = dis_CO1_matrix_NE,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

#plot matrix (18S)
dis_18S_matrix_NE <- ggplot(longData18S, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longData18S, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "green4", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (NE)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_18S_matrix_NE

ggsave(filename = "Figures/PCR_replicates/dis_18S_matrix_NE_curated_98.png", plot = dis_18S_matrix_NE ,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

North Wales

#| label: north-wales-replicate-plots

#### Comparison taxa plot 
run_replicates_taxa_plot_NW <- microbiome::plot_composition(phylum_pseq) + 
  xlab("Sample") + ylab("Relative abundance")+
  scale_x_discrete(limits = c(NW_reps))

run_replicates_taxa_plot_NW

#### Dissimilarity 

#Jaccard dissimilarity (based on P/A) - high value = most different
replicates_NW_phylo <- phylo_eDNA_decontam_filtered %>% subset_samples(fullID %in% NW_reps) # subset phylo
run_replicates_dis_jaccard_NW <- as.matrix(distance(replicates_NW_phylo, "jaccard", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(run_replicates_dis_jaccard_NW)
longData<-longData[longData$value!=0,]

# Add TRUE or FALSE variable for replicates
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle) == sapply(longData$Var2, extract_middle), TRUE, FALSE)

# Extract the last section of the sample names
longData$primerVar1 <- sub(".*_(18S|CO1)$", "\\1", longData$Var1)
longData$primerVar2 <- sub(".*_(18S|CO1)$", "\\1", longData$Var2)
longData_sameprimer <- filter(longData, primerVar1 == primerVar2)

#Individual primer datasets
longData18S <- subset(longData_sameprimer, primerVar1 == "18S")
longDataCO1 <- subset(longData_sameprimer, primerVar1 == "CO1")

#plot matrix (CO1)
dis_CO1_matrix_NW <- ggplot(longDataCO1, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longDataCO1, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "coral3", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (NW)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_CO1_matrix_NW

ggsave(filename = "Figures/PCR_replicates/dis_CO1_matrix_NW_curated_98.png", plot = dis_CO1_matrix_NW,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

#plot matrix (18S)
dis_18S_matrix_NW <- ggplot(longData18S, aes(x = Var2, y = Var1)) + 
  geom_tile(aes(fill = value), color = "white") +
  geom_point(data = subset(longData18S, replicate == TRUE), 
             aes(x = Var2, y = Var1), 
             color = "black", size = 8, shape = 0, fill = NA) +
  geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
  scale_fill_gradient(low = "green4", high = "grey95", name = "Jaccard Dissimilarity") +
  labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1 (NW)") +
  theme_bw() + 
  theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
        axis.text.y = element_text(size = 9),
        plot.title = element_text(size = 11))

dis_18S_matrix_NW

ggsave(filename = "Figures/PCR_replicates/dis_18S_matrix_NW_curated_98.png", plot = dis_18S_matrix_NW,
       device = "png", dpi = 300, units = "mm", height = 200, width = 250)

Join comp plots together for export.

#| label: join-run-reps-plot

all_region_reps <- cowplot::plot_grid(
  run_replicates_taxa_plot_NW + theme(legend.position = "none"),
  run_replicates_taxa_plot_SW + theme(legend.position =
                                        "none"),
  run_replicates_taxa_plot_SCH + theme(legend.position =
                                         "none"),
  run_replicates_taxa_plot_CN ,
  run_replicates_taxa_plot_NE + theme(legend.position =
                                        "none"),
  labels = c("a", "b", "c", "d", "e"),
  ncol = 2,
  align = "hv"
)

all_region_reps

ggsave(filename = "Figures/all_region_reps.png", plot = all_region_reps,
       device = "png", dpi = 300, units = "mm", height = 350, width = 270)

Within shore heights

We need to get a list of sites for the following loop.

#| label: side-ids-get

site_ids <- unique(sample_data(phylo_eDNA_decontam_filtered)$localityID) %>% na.omit() # Add more site IDs as needed   

Similar to above, we need to calculate the relative abundances, but this time for the whole data set.

#| label: calculate-relative-abundance

#Transform abundance table to a relative abundance (compositional) table
pseq_relabund <- microbiome::transform(phylo_eDNA_decontam_filtered, "compositional")

#Phylum phyloseq
phylum_pseq <- microbiome::aggregate_taxa(pseq_relabund, "phylum", verbose = FALSE)

Generate plots for COI samples.

#| label: CO1-field-rep-comp-plots

#CO1 plots
# Define a function to generate and save the taxa plot for a given site
generate_taxa_plot_CO1 <- function(site_id) {
  
  # Subset samples for the given site
  site_samples_CO1 <- subset_samples(phylo_eDNA_decontam_filtered, localityID == site_id & primer == 'CO1')
  sample_names_CO1 <- sample_names(site_samples_CO1)
  
  # Extract the shorePosition variable
  shore_positions <- sample_data(site_samples_CO1)$shorePosition
  names(shore_positions) <- sample_names_CO1
  
  # Generate the taxa plot
  taxa_plot <- microbiome::plot_composition(phylum_pseq) +
    xlab("Sample") + ylab("Relative abundance") +
    scale_x_discrete(limits = sample_names_CO1)
  
  # Save the plot
  ggsave(
    filename = paste0(
      "Figures/field_replicates/CO1/field_replicates_taxa_plot_",
      site_id,
      "_CO1.png"
    ),
    plot = taxa_plot,
    device = "png",
    dpi = 300,
    units = "mm",
    height = 200,
    width = 450
  )
}

# Loop through each site ID and generate the plot
for (site_id in site_ids) {
  generate_taxa_plot_CO1(site_id)
}

And for 18S samples.

#| label: 18S-field-rep-comp-plots

#18S plots
# Define a function to generate and save the taxa plot for a given site
generate_taxa_plot_18S <- function(site_id) {
  
  # Subset samples for the given site
  site_samples_18S <- subset_samples(phylo_eDNA_decontam_filtered, localityID == site_id & primer == '18S')
  sample_names_18S <- sample_names(site_samples_18S)
  
  # Generate the taxa plot
  taxa_plot <- microbiome::plot_composition(phylum_pseq) +
    xlab("Sample") + ylab("Relative abundance") +
    scale_x_discrete(limits = sample_names_18S)
  
  # Save the plot
  ggsave(
    filename = paste0("Figures/field_replicates/18S/field_replicates_taxa_plot_", site_id, "_18S.png"), 
    plot = taxa_plot, 
    device = "png", 
    dpi = 300, 
    units = "mm", 
    height = 200, 
    width = 450
  )
}

# Loop through each site ID and generate the plot
for (site_id in site_ids) {
  generate_taxa_plot_18S(site_id)
}

Now dissimilarity for both primers.

#| label: dis-field-rep-plots

generate_dis_plot <- function(site_id) {
  
  # Subset samples for the given site
  site_samples <- subset_samples(phylo_eDNA_decontam_filtered, localityID == site_id)
  sample_names <- sample_names(site_samples)
  
  #Jaccard dissimilarity (based on P/A) - high value = most different
  site_dis_jaccard <- as.matrix(distance(site_samples, "jaccard", binary = TRUE)) # run analyses
  
  # format matrix to long
  longData<-melt(site_dis_jaccard)
  longData<-longData[longData$value!=0,]
  
  #Split primers
  # Extract the last section of the sample names
  longData$primerVar1 <- sub(".*_(18S|CO1)$", "\\1", longData$Var1)
  longData$primerVar2 <- sub(".*_(18S|CO1)$", "\\1", longData$Var2)
  longData_sameprimer <- filter(longData, primerVar1 == primerVar2)
  
  #Individual primer datasets
  longData18S <- subset(longData_sameprimer, primerVar1 == "18S")
  longDataCO1 <- subset(longData_sameprimer, primerVar1 == "CO1")
  
  #plot matrix (CO1)
  dis_CO1_matrix <- ggplot(longDataCO1, aes(x = Var2, y = Var1)) + 
    geom_tile(aes(fill = value), color = "white") +
    geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
    scale_fill_gradient(low = "coral3", high = "grey95", name = "Jaccard Dissimilarity") +
    labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity CO1") +
    theme_bw() + 
    theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
          axis.text.y = element_text(size = 9),
          plot.title = element_text(size = 11))
  
  dis_CO1_matrix
  
  # Save the plot
  ggsave(
    filename = paste0("Figures/field_replicates/CO1/field_replicates_dis_plot_", site_id, "_CO1.png"), 
    plot = dis_CO1_matrix, 
    device = "png", 
    dpi = 300, 
    units = "mm", 
    height = 200, 
    width = 250
  )
  
  #plot matrix (18S)
  dis_18S_matrix <- ggplot(longData18S, aes(x = Var2, y = Var1)) + 
    geom_tile(aes(fill = value), color = "white") +
    geom_text(aes(label = round(value, 2)), color = "black", size = 3) + # Add text labels
    scale_fill_gradient(low = "green4", high = "grey95", name = "Jaccard Dissimilarity") +
    labs(x = "Samples", y = "Samples", title = "Matrix of Jaccard Dissimilarity 18S") +
    theme_bw() + 
    theme(axis.text.x = element_text(size = 9, angle = 90, vjust = 0.3),
          axis.text.y = element_text(size = 9),
          plot.title = element_text(size = 11))
  
  dis_18S_matrix
  
  # Save the plot
  ggsave(
    filename = paste0("Figures/field_replicates/18S/field_replicates_dis_plot_", site_id, "_18S.png"), 
    plot = dis_18S_matrix, 
    device = "png", 
    dpi = 300, 
    units = "mm", 
    height = 200, 
    width = 250
  )
  
}

# Loop through each site ID and generate the plot
for (site_id in site_ids) {
  generate_dis_plot(site_id)
}

Overall visualization of replicate dissimilarity

Let’s compare average dissimilarity across different replicate comparisons.

#| label: subset-replicates

phylo_replicates_pairs = subset_samples(phylo_eDNA_decontam_filtered, pairedRepLogical == TRUE) 
phylo_replicates_pairs
phyloseq-class experiment-level object
otu_table()   OTU Table:         [ 1026 taxa and 119 samples ]
sample_data() Sample Data:       [ 119 samples by 42 sample variables ]
tax_table()   Taxonomy Table:    [ 1026 taxa by 13 taxonomic ranks ]
#| label: jaccard-replicate-calculate

# Identify the logical variable indicating replicates
jaccard_dissimilarity<- as.matrix(distance(phylo_replicates_pairs, "jaccard", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(jaccard_dissimilarity)
longData<-longData[longData$value!=0,]

# remove repeated combinations of var 1 and var 2
cols = c("Var1", "Var2")
longData <-longData[!duplicated(t(apply(longData[cols], 1, sort))), ]

# Add TRUE or FALSE variable for replicates
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle_all) == sapply(longData$Var2, extract_middle_all), TRUE, FALSE)

# Extract the last section of the sample names
longData$primerVar1 <- sub(".*_(18S|CO1)$", "\\1", longData$Var1)
longData$primerVar2 <- sub(".*_(18S|CO1)$", "\\1", longData$Var2)
longData$sameprimer <- longData$primerVar1 == longData$primerVar2
longData$samesite <- extract_site(longData$Var1) == extract_site(longData$Var2)

longData_sameprimer <- filter(longData, primerVar1 == primerVar2)

#Individual primer datasets
longData18S <- subset(longData_sameprimer, primerVar1 == "18S")
longDataCO1 <- subset(longData_sameprimer, primerVar1 == "CO1")

#add sample type
meta_rep <- data.frame(sample_data(phylo_replicates_pairs))

meta_rep <- meta_rep %>%
  mutate(
    sampleType = case_when(
      fieldID == "PHD2-NE05-08rep" ~ "plate-replicate",  # Change if fieldID matches
      TRUE ~ sampleType  # Keep existing value otherwise
    )
  )

# add var1 type
longData <- longData %>%
  left_join(meta_rep %>% dplyr::select(fullID, sampleType), 
            by = c("Var1" = "fullID")) %>%
  dplyr::rename(typeVar1 = sampleType)

# Joining var2 type
longData <- longData %>%
  dplyr::left_join(meta_rep %>% dplyr::select(fullID, sampleType), 
            by = c("Var2" = "fullID")) %>%
  dplyr::rename(typeVar2 = sampleType)

longData$sametype <- longData$typeVar1 == longData$typeVar2
longData_sametype <- filter(longData, typeVar1 == typeVar2)

# define an overall type of the pairwise comparison for the plot and remove unneeded groups
longData <- longData %>%
  mutate(overallType = paste(pmin(typeVar1, typeVar2), pmax(typeVar1, typeVar2), sep = "-")) %>% 
  filter(!grepl("failed-repeat", overallType)) %>% 
  filter(!grepl("sample-sample", overallType)) %>% 
  filter(!grepl("plate-replicate-plate-replicate", overallType))

# Plotting the boxplot using ggplot2
standard_error <- function(x) {
  sd(x, na.rm = TRUE) / sqrt(length(x))
}

# Calculate the averages for each group
averages <- longData %>%
  dplyr::group_by(replicate, samesite) %>%
  dplyr::summarise(mean_value = mean(value, na.rm = TRUE), .groups = 'drop',
                   standard_error = standard_error(value))

averages
# A tibble: 3 × 4
  replicate samesite mean_value standard_error
  <lgl>     <lgl>         <dbl>          <dbl>
1 FALSE     FALSE         0.963       0.000613
2 FALSE     TRUE          0.930       0.00533 
3 TRUE      TRUE          0.667       0.0143  
#| label: jaccard-replicate-plot

compare_reps_jaccard_types <- ggplot(longData, aes(x = replicate, y = value, fill = overallType)) +
  geom_boxplot() +
  labs(x = "Replicate",
       y = "Jaccard Dissimilarity") +
  scale_fill_manual(values = c("plate-replicate-run-replicate" = "lightblue", 
                               "plate-replicate-sample" = "lightgreen",
                               "run-replicate-run-replicate" = "gold",
                               "run-replicate-sample" = "pink"), 
                    labels = c("plate-replicate-run-replicate" = "Plate replicate vs run replicate", 
                               "plate-replicate-sample" = "Plate replicate vs sample",
                               "run-replicate-run-replicate" = "Run replicate vs run replicate",
                               "run-replicate-sample" = "Run replicate vs sample"),
                    name = "Replicate type") +
  theme_classic()+
  theme(legend.position = "none")
#| label: bray-replicate-calculate

# Identify the logical variable indicating replicates
bray_dissimilarity<- as.matrix(distance(phylo_replicates_pairs, "bray", binary = TRUE)) # run analyses

# format matrix to long
longData<-melt(bray_dissimilarity)
longData<-longData[longData$value!=0,]

# remove repeated combinations of var 1 and var 2
cols = c("Var1", "Var2")
longData <-longData[!duplicated(t(apply(longData[cols], 1, sort))), ]

# Add TRUE or FALSE variable for replicates
longData$replicate <- ifelse(sapply(longData$Var1, extract_middle_all) == sapply(longData$Var2, extract_middle_all), TRUE, FALSE)

# Extract the last section of the sample names
longData$primerVar1 <- sub(".*_(18S|CO1)$", "\\1", longData$Var1)
longData$primerVar2 <- sub(".*_(18S|CO1)$", "\\1", longData$Var2)
longData$sameprimer <- longData$primerVar1 == longData$primerVar2
longData$samesite <- extract_site(longData$Var1) == extract_site(longData$Var2)

longData_sameprimer <- filter(longData, primerVar1 == primerVar2)

#Individual primer datasets
longData18S <- subset(longData_sameprimer, primerVar1 == "18S")
longDataCO1 <- subset(longData_sameprimer, primerVar1 == "CO1")

#add sample type
meta_rep <- data.frame(sample_data(phylo_replicates_pairs))

meta_rep <- meta_rep %>%
  mutate(
    sampleType = case_when(
      fieldID == "PHD2-NE05-08rep" ~ "plate-replicate",  # Change if fieldID matches
      TRUE ~ sampleType  # Keep existing value otherwise
    )
  )

# add var1 type
longData <- longData %>%
  left_join(meta_rep %>% dplyr::select(fullID, sampleType), 
            by = c("Var1" = "fullID")) %>%
  dplyr::rename(typeVar1 = sampleType)

# Joining var2 type
longData <- longData %>%
  dplyr::left_join(meta_rep %>% dplyr::select(fullID, sampleType), 
                   by = c("Var2" = "fullID")) %>%
  dplyr::rename(typeVar2 = sampleType)

longData$sametype <- longData$typeVar1 == longData$typeVar2
longData_sametype <- filter(longData, typeVar1 == typeVar2)

# define an overall type of the pairwise comparison for the plot and remove unneeded groups
longData <- longData %>%
  mutate(overallType = paste(pmin(typeVar1, typeVar2), pmax(typeVar1, typeVar2), sep = "-")) %>% 
  filter(!grepl("failed-repeat", overallType)) %>% 
  filter(!grepl("sample-sample", overallType)) %>% 
  filter(!grepl("plate-replicate-plate-replicate", overallType))

# Plotting the boxplot using ggplot2
standard_error <- function(x) {
  sd(x, na.rm = TRUE) / sqrt(length(x))
}

# Calculate the averages for each group
averages <- longData %>%
  dplyr::group_by(replicate, samesite) %>%
  dplyr::summarise(mean_value = mean(value, na.rm = TRUE), .groups = 'drop',
                   standard_error = standard_error(value))

averages
# A tibble: 3 × 4
  replicate samesite mean_value standard_error
  <lgl>     <lgl>         <dbl>          <dbl>
1 FALSE     FALSE         0.881        0.00178
2 FALSE     TRUE          0.812        0.0119 
3 TRUE      TRUE          0.360        0.0147 
#| label: bray-replicate-plot

compare_reps_bray_types <- ggplot(longData, aes(x = replicate, y = value, fill = overallType)) +
  geom_boxplot() +
  labs(x = "Replicate",
       y = "Bray Dissimilarity") +
  scale_fill_manual(values = c("plate-replicate-run-replicate" = "lightblue", 
                               "plate-replicate-sample" = "lightgreen",
                               "run-replicate-run-replicate" = "gold",
                               "run-replicate-sample" = "pink"), 
                    labels = c("plate-replicate-run-replicate" = "Plate replicate vs run replicate", 
                               "plate-replicate-sample" = "Plate replicate vs sample",
                               "run-replicate-run-replicate" = "Run replicate vs run replicate",
                               "run-replicate-sample" = "Run replicate vs sample"),
                    name = "Comparison") +
  theme_classic()
#theme(legend.position = "none")

Join and plot for export.

types_boxplot <- cowplot::plot_grid(compare_reps_jaccard_types, compare_reps_bray_types, labels = c("a", "b"), ncol = 2, rel_widths = c(1.6, 2.6) )

types_boxplot

ggsave(filename = "Figures/types_boxplot.png", plot = types_boxplot,
       device = "png", dpi = 300, units = "mm", height = 170, width = 250)

Concluding remarks

We have now tidied, decontaminated, and filtered our eDNA metabarcoding data and used a variety of visualizations to quality check our data. Further ecological analyses will be presented in separate Markdown documents using the data generated in this workflow.